Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1609  (registered. 2012)
Contig Information
Length 1074 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_EM Dormant seed with water absorption 2
Wh_VHS Shoot with heat shock treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|11132027|sp|O04437.1|GSTZ_WHEAT|GSTZ_WHEAT RecName: Full=Glutathione S-transferase; AltName: Full=GST
Score 434
Evalue 9.00E-120
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1609
GAAAATCGGTTATAGATACAGGTCAATTCGTCAAATCACCTTTTTTTTCTGCTGAATCTCACTGGTGGTGAATCGATAAATATTAATTTACATGGTGCCG
GAGCCCGGCCGGCAGCTCGGCATGGCATGTAGAGGAGCTTCTTCCACGCATGGTGACTTATATATTTGGAATACTAAATTTTCATTAGATGCCCTATGCA
CCTGGACGGAGGGAGCAAGTTATGACTTATGAGAGGTTCTTCAATTGCAGACTACTACATTCCTCATTATTGCATAAATTACACGCATATAGTTGTAACT
GGCTTGATTTCTTGATTATTTTGCTGAAGGTGCATCTGGCTGATTCTGGGGCAGTGCAGCTTGAAATGCCGGAATTTTCATGTATGCGTCGTGAAGTCGC
GACAATATTGGGTACTTCGTCATATCAATCTGGAAGCGATTGATGGCGGCATGGATCTGTGGGGCTAGACACACATCTCCCAAATGGACTTCATCTCCAA
CGCAATATTTGCTGTCACATCCATCCAAAAGCTTTTCGATTGCTCTGAAGCCCTTGTCAATATAACGTTGAACCACCTCAAGGCTCTCATCGGGGCTCAA
CCTACCCTCATGTAAACCAATTACGCCGTAGCCTTGGAGAGGTTGGATGCTTGAGCAAACTATGTTCGCAATCTGAAGATCAAGACCTTTCGTTTTGATA
TCTTTAGGTACGAGAGGATGCTGAGGATACTTATCCTCCAGATACAACATGATAGCGAGAGAATCAGATAGAACAAAGTCCCCATCTACCAATGCTGGTA
TGTATTTGATCGGGTTTATTTTTTCATAGTCTGGATCTGTCCGAGGATTGACTGCCTTATACTCATAGTCCACACCTTTGAGGTTGAGAGCGATCCGGAC
ACGGTGAGAGCAAGAGCTGATCCAGGCGCCGTACAGGATGGGCTTGGCCGCCGCCATGGCTGACTGCTACCCCTTTCTCCTCTTCCTCCACTACTAGATG
GAGACGATGCAGCAGTATGTGACTATATTTATTGGTATGGAGAGCCGGAGAAGGGATTGTCTTCTCCTCTCCTC
page-top