Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16079  (registered. 2012)
Contig Information
Length 631 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
WH_XN Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|255677539|dbj|BAH93794.1|| Os07g0164900 [Oryza sativa Japonica Group]
Score 155
Evalue 3.00E-36
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16079
ATAGGGAGGTCCCATGACCATGTCTCATCATGCTCCAAGTATACATCTTCCATTTGTTTACTCTCATCGTTTTGCCTATTTGAGTCACAAATACCTGTAT
CCATCCATCAGTCTAGTACAAAATGTTACCTAAGAACTATGTACTGTAAGTCCGTACCTGAATGAAATTATCGAACAAATGTGGCACAACCAAACAAAAT
TCTGTTATAGTCGAATGGTGCATGCGTTAACAAGTGGATCACACAGTACCTTCTAGTATGCCCAGAGTACTATGCAAGAAGTATACCTTATAATGCTATC
ATTATAATTTACTTTGCCAAATGTGAAATTCGTCTGTATTTATTTGGAACCCACTAGAGTTTCCAAATACTTCTCCACATTGTCCAAGCCACACAGCTCC
TTCACCACAGGCATGATTGCCGGAACTTCCAACTCAAAGAACGAAGGTGAAGACGATCCAGACCCACAACAGTGGAGTTCCTTCCGTGCTGCGGCAATTG
CATCCCTTGTTGCGCAGTGAACTGAAGCTGCAAGGAGCAAAGGCGGCTCCCCAGATGCTTTTGAAGACAGCACTCTCTTCTTGTGAAATCCACTGTTGCG
CAGCTCAACATTAAACTGTTTAGGGATGGTG
page-top