Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1607  (registered. 2012)
Contig Information
Length 810 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218202444|gb|EEC84871.1|| hypothetical protein OsI_32014 [Oryza sativa Indica Group]
Score 331
Evalue 7.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1607
CATATTGGCATATTAATATTTTCGCATATACATCAACATAGACATATACATTTAGGAACAATCGAATCCAAAGAAGCAGAGACCTGTATATAAACCCTAC
TGCCCAAGCAAAATTCAATTACCATCCAAAAACAACACCCAACCATCTTCCCAGGCTTATTCATCGTCCATCCTCCTCTCCGTGGGCTACAGAATCTTCA
GGCGTGCCAAATCACTGCGAATAAGCCTGGCCGGGCAGAGCCACCGGCCTGAGCTCACCGCCACGGAGGAAGCCGGCGAACCACTTGGCGGAGTGCCTCT
GGTACCTCGTCCTCTCCTCGGAGTTGAAGTCGACGCCATAGAGGCCGAAGCCCATGCGGTAGCCAAACAGATACTCGAACACGTCCAGAAACGACCACAC
GAAGTAGCCCTGCACGTTCGACCCGTTCCTGCTGGATTCGAGGGTCGCCTCGATGTAATCCTGCAGGTACTGCGACCTGAACTCGTCGTCGGGGGCGTTT
CCGGCAGAAGGATCCGCAATGCTAGCAGCTCCGTTCTCATGGATCATGACTATAGGGTTCTTGTATTTGAGCTGGAGATGCTCCAGCATTTTCTTCAGAG
CCCACGGTGTCGATGTCATGAAATCGCTTTTCAACCCAAACAGGAGCTGGTTCTTCTTCAAAAATGGCATGTCATATTTCACGGCTGCATCACCCATGTA
ATCTCTCAGCTCATCATCCAGCTTGCTAAGATCAGCCTTAACATATACCGCAATGTAGTGGTTAAATCCGACAAAATCGAAAGATCCGAGCACCCTCTTC
AGTTCTTCGT
page-top