Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16028  (registered. 2012)
Contig Information
Length 824 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
WH_XV Leaves, plant was grown at constant 23 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242032609|ref|XP_002463699.1|| hypothetical protein SORBIDRAFT_01g004480 [Sorghum bicolor]
Score 200
Evalue 1.00E-49
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig16028
ATAATTCAGCAGGAAACCCATCTGGTCCTGGTGTGCTAAAGTAGTTAAATAACAAACCACCTCAACAAATCTCGTGTGGGCTTGATTAGTAGTCAGACGA
CCTTCATGCACCTTACCAGATGGCCTCCAGCTAGTATGATACTCCAGCTAGTAGTAGATGCAAAGTATATATAGTCTGATGCCTAGAGTTGTAGAATGCG
GCATGGACAAACGATGCACATTGACGTCCTTCTAATTCCTCCTATGTCAAAGGATCTCATTCCGTATCATAGGGTTTTCCATTTTGTTGTATTGCGACAG
TGTAATTAATACATAAACGGTATGATTACAAGCATTACAAATTACCCGAAACCAATTTTGTTTACATAAATAGTGTCTACAGTATTCTTCGGGCCATTGT
TACTGTTGGGCTTCAGGCTCTTTCTTCTCCAGGTAACCTTGAGCCCTAGCATAGCGAGATAACTGGTAGAGCTGAACGCTTTCGTTGGAGGCATGGGTTG
CCATAAGAAAATAGTTCCGGGGCCGTACCACCCATGCGAACCTCATAAATAGGCCAGAATACACACACATGACTGCAGTCATATGGCCGGATATCAATTC
AGGTGGCTTGTTCATGTCAGCCATACCCGCGAGGATGAAGCCCCAGTTGCTGACGGGTCCCCAGAAGTGCGTGGTCCTGGGGCCGACGGGGCTGTTCAAG
AACGCCTTGAACGCCGTGGCCATGGCGGAGAACCTCGCCCCCTCTACGGCTGTTTGCCTGCCGTCCGCGGGTGCGGATGGACTCGTGGAGACGGCCAACA
GGTGAGCGGCACGAGGCCTCGTGC
page-top