Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15997  (registered. 2012)
Contig Information
Length 1018 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242087069|ref|XP_002439367.1|| hypothetical protein SORBIDRAFT_09g005230 [Sorghum bicolor]
Score 337
Evalue 1.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15997
GGCAAACACTCTATTTTTATTGAATTGATGATACTATATGCATCAAACCGTTTGTATGGGAGAAGGGGACGATGAGCAAACTACAAGGACTAAAAGGGTG
CATCAAAGCATGAACCACCCATGGAGACAATGATCTTGGGGAGAGAAAGAAGCATCGCAAGCACGACTATCAGTTCAATGTAAACAAATACAAAAAACCA
GTCCCCAATTTGATCAGGCTCGCCCCCTCCGCGAATCATCTAAGGGGGGCGATATGTATCGAATGTAAGACAACGCAAATGGAAAAGGCATTGTTTATTA
CAGGCCTAAAAATACCACTCACGCTCCGACGCAGGCATCCTCCTCTCCCTCCGTTATTCCAAGCTTCTGGGCACGAGACCTTCAAGTGTGGTGTTTGTTC
TTTGCCATCAACGATGACAGAACCTCGACGAGTGTGCGATCTTACAGGCTCTTGGCTGCGGCAATGACGCTCTCCGCGGTGATGCCGTACTCCTTGTAGA
TCTTCGGGGCAGGAGCGCTGGCGCCGAACTTGTCGATGCCGATGGTCTTGCCCTTGGATCCAACGTACTTTTGCCATCCGAGGGTAGAGCCAGCCTCAAT
GCTGATCCTTGCGGTGACAGCCTCAGGGAGCACGCTCTCCTTGTATTCATCTGACTGCTCGTCGAAAAGCTCCCAGCAGACAAATGACACAACGCGGACA
GTCTTCCCCTCCTTCGTCAACTCTTCGGCAGCCTTCACAGCAATCTCTACCTCAGAACCAGTGCTCATTATGATGAAGTCAGGCTTGTTGTCGGTCGAGT
TGTCAGAGATAGTGTATCCACCCTTCGCAACGCCCTCAATTGAGGTACCAGGCAGATGAGGAAGCTTTTGCCTGGAGAGAGCCAGAATAGATGGCCTCTT
CCTGTTGAGGACAGCCACCTTGTATGCCCCGGCAGTCTCCTTGCCATCAGCAGGACGGAACATCAGCATGTTTGGCATCGCACGGAAGCTCACCAAGTGC
TCAATGGGTTGATGGGTC
page-top