Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15965  (registered. 2012)
Contig Information
Length 1319 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
WH_XN Leaves, plant was grown at constant 23℃ 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|255673884|dbj|BAF06745.2|| Os01g0853400 [Oryza sativa Japonica Group]
Score 667
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15965
ATCAGTGAGTGTGACCTTTCAGACCTGATTGGTTTTTTCGAAGCAGCCAATGCATTGCAAGATTTTGCTGGAGGATCGTTCAATGAGGTAGGAGAGCTAA
CAAAGTATGAAAAAGTCAAGTTTCCACCAAGAGTATGCTTCTTGGGGCTTACGTTCATGGGGAAAAATGAGATGCCTGTTATCTTCCCTTTTTCTGCTTC
ATTAAAGAAACTGGACTTGCAGTACACTTTCCTCACCACTGAGGATCATTGCCAGCTTATCTCAAAATGCCCGAACCTATTTGTTCTCGAGGTGAGGAAT
GTGATAGGAGACAGAGGGCTAGAGGTTGTTGGTGATACATGCAAGAAGCTACGAAGACTTCGAATTGAGCGAGGGGATGATGATCCAGGTCTCCAAGAAG
AGCAAGGAGGAGTTTCTCAGTTAGGCCTGACAGCGGTAGCTGTTGGTTGCCGTGACCTGGAGTACATAGCTGCCTATGTATCTGATATCACCAACGGCGC
TCTCGAATCCATCGGGACCTTCTGCAAAAATCTCTACGACTTCCGGCTTGTCCTGCTCGACAGACAAAAGCAGGTAACCGATCTGCCGCTCGACAACGGT
GTTCGAGCTCTGTTAAGGAGCTGCACCAAGCTCCGGAGATTTGCTCTCTACCTGAGACCTGGAGGGCTCTCAGACACAGGCCTCGACTACATCGGGCAGT
ACAGCGGCAACATCCAGTACATGCTACTGGGCAACGTCGGCGAATCGGACCACGGGTTGATCCGCTTCGCAATAGGATGCACCAACCTGCGGAAGCTTGA
GCTTCGGAGCTGCTGCTTCAGCGAGCAAGCCCTGTCCCTCGCGGTGCTCCACATGCCCTCGCTCAGGTACATATGGGTGCAAGGCTACAAGGCCTCTCCA
GCAGGCCTGGAGCTCCTCCTCATGGCGAGGCGATTCTGGAACATCGAGTTCACGCCCCCCAGCCCCGAGGGCTTGTTCCGCATGACGCTCGAAGGAGAAC
CCTGCGTGGACAAGCAGGCCCAGGTTCTTGCCTACTACTCCCTTGCCGGGCAGAGGCAGGACTGCCCTGACTGGGTGACCCCGTTGCATCCAGCCGCATG
AATGATTGTAAATACATCTAGTTGTGTGTACGTACCTACTGTACCTTATGTTGCCCTTGGGTCCCTTTGGCAAGAACCGTATCTGAATATGGCAATTTGT
ATGGATGTAGATCATTAGCTTAGCTGCTTTGGTGCCCTAATAAGCTAGTAGTGCTGTAGCTGAGGTGTAGTACAATAAGTTGCCGTTGTCGCTTGTACTA
CTATGTATGTAATCCTGGG
page-top