Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15963  (registered. 2012)
Contig Information
Length 1218 bp
Clones alternative view 68 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 9
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 5
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23Ž 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 8
WH_XE Seedling, infected with leaf rust 10
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|112030956|gb|ABH88068.1|| photosystem II protein D1 [Phaseolus vulgaris]
Score 723
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15963
GCTGGAGTACGGTAGGGCACGGTGCCTCGTGCCGAATTCGGCACGAGGGTGTGCTTGGGAGTCCTTGCAATTTGAATAAACCAAGATCTTACCATGACTG
CAATTTTAGAGAGACGCGAAAGTACAAGCCTGTGGGGTCGCTTCTGCAACTGGATAACTAGCACTGAAAATCGTCTTTACATCGGATGGTTCGGTGTTTT
GATGATCCCTACCTTATTGACCGCAACTTCTGTATTTATTATCGCCTTCATCGCTGCCCCTCCAGTAGATATTGATGGTATTCGTGAGCCTGTTTCTGGT
TCTTTACTTTATGGAAACAATATTATCTCTGGTGCTATTATCCCTACTTCTGCGGCGATCGGATTGCACTTTTACCCAATTTGGGAAGCTGCATCTGTTG
ATGAGTGGTTATACAATGGTGGTCCTTATGAGCTAATTGTTCTACACTTCTTACTTGGTGTAGCTTGTTATATGGGTCGTGAGTGGGAACTTAGTTTCCG
TCTGGGTATGCGTCCTTGGATTGCTGTTGCATATTCAGCTCCTGTTGCAGCTGCTACTGCTGTTTTCTTGATTTACCCTATTGGTCAAGGAAGCTTTTCT
GATGGTATGCCTTTAGGAATCTCTGGTACTTTCAACTTTATGATTGTATTCCAGGCAGAGCACAACATCCTTATGCATCCATTCCACATGTTAGGTGTAG
CTGGTGTATTCGGCGGTTCCCTATTCAGTGCTATGCATGGTTCCTTGGTAACCTCTAGTTTGATCAGGGAAACTACTGAAAATGAATCTGCTAATGAGGG
TTACAAATTTGGTCAAGAGGAAGAAACTTATAATATTGTGGCTGCTCATGGTTATTTTGGCCGATTAATCTTCCAATATGCTAGTTTCAACAACTCTCGT
TCTTTACACTTCTTCTTGGCTGCTTGGCCTGTAGTAGGAATCTGGTTCACTGCTTTAGGTATTAGTACTATGGCTTTCAACCTAAATGGTTTCAATTTCA
ACCAATCTGTAGTTGATAGTCAAGGTCGCGTTATTAATACTTGGGCTGATATCATCAACCGTGCTAACCTTGGTATGGAAGTAATGCACGAACGTAATGC
TCACAACTTCCCTCTAGACTTAGCTGCTGTTGAAGTTCCATCTATTAATGGATAAGGTTTTTCTGCTAACATATAAGAATTTTTGAAGAAAAAAAGCGTG
GTGGCAAGCCCGATCCTC
page-top