Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15960  (registered. 2012)
Contig Information
Length 1539 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_CSEC Callus 1
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XF Seedling, infected with leaf rust 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226503143|ref|NP_001146320.1|| hypothetical protein LOC100279896 [Zea mays]
Score 735
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15960
AAGTTATAGTATTAGAGTATAGTGACCATACTTCAACTTTGGCAGTACTTGAGGACTAAGAAGAAAAACAAAACCCTTTTCATTTGAATAATATGAACCT
CATTGGCGCATTGATAGCCACACGTTCGCAGCCAGGAAAAGCGCGTGAACAAGGAGGAAAAGGGATGCCGTGATACTGCCAACTCGCCACATTTTCCTTT
TCTTTCCGAACGTAGCAACATGCTTCACATGCTAACTCGCCGCTACAAGCGCACCACGAGCCTCCGTATTTGATCTCCTCTGTTGCCTATCAGTCCGCTT
CCTGCTACGCCACAGTAGGCGAATAGGCGTGCCCGGGAATCCGGCGTCAGACCGGAGCTGCTTGTGCATGTACCGCCGATACGGCTCAGGGAAGAGTTTT
GCGTCATTAACGAAGAGAACAAACGTTGGTGGACGAACAGCAGCCTGTGTTGTGTAATAAACACGGCCTCTTTTGCCACCTCTTGTTCGTGGTGGTGCTT
TGAATGCTACAGCTTCTCTAACCACTTGGTTAAGAATAGAGGTGCCAAGTCTTCTAGACCTTTCCTTTTCAACCAAAGAAGCAGCAGAAATGATCTTTTC
AACGCTGTTCCCATTTATCGCAGAACAGTAAACAATAGGTGCCCAGTCAAGTACACGAAGCTTCTCTCTTACATCCTGTTCATAATGTGTAGTACTCTCA
TTGTTCTTGTTTGGGATTGTGTCCCATTTGTTCACAACAATGACACATGCCTTTCCCTCTTTCTCAATCCTTTCTGCAATTTTATAATCCTGCTCCGAGA
CGCAGGCCATCGCTTCAATAACAAGGGCAACTACATCAGATCGACGAATTGCACTAAATGCACGTTTTACTGAAAGTGTTTCAGTTGTGCTGCCAGCAGA
AGCAACTGCTGCTCTCCGTCGGATGCCAGCCGTATCGATGAGTTTGTATTTCTGCCCATCCACTGTGGTTAACTCAGTATCAATGGCATCACGGGTGGTA
CCACTAACTGGGCTCACAATAGTTCTATCTTCTCCAACCAAAGCATTTAGAATGCTACTTTTCCCAACATTTGGTCTTCCAACAATAGAAATAGCAGGAA
CGCGGTTTTCGTCTTCTTCAACATCATCCAATCCTTCTAGTCCCTCGAACTTTTTCAGTTCCGAACAGACCATATCCAGGAGCTCTCCAGTTCCAGTGCC
GGTGATAGCAGATATTGGTAAAGGTGTAAACCCTAATGACCAAAATTCTAATGCTTGCATTTGCCCTTTCCGTGGCGATTCACACTTGTTTACAGCCAGT
ATGATGCACTTGTGTGAGAAGTTGCGACGTAACCAATCAGCAATTTCTATATCAGCTGCCACAAGACCAGCCTGACCATCCACAAGGAAAAGAAGGACAG
CTGCTTCTTCAACGGCAGCAACAGCTTGCTTCTCAATCATAGATGGCATCCTAGCAATAGCAGCTTCTCGAGAGGCCATTGGAATCCCATCCATACCAAC
AGTAGTTGTGATTGCAAGTTCTTCCATTACACCTGCTTG
page-top