Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15959  (registered. 2012)
Contig Information
Length 1372 bp
Clones alternative view 36 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 5
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|212722662|ref|NP_001132226.1|| hypothetical protein LOC100193661 [Zea mays]
Score 571
Evalue 7.00E-161
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15959
CTCCCACACCGCCCCCCTCCTCGGCCATCCTCATCTCGCCTGTGCTCTCCACACGACCACACCAAAAAATCCAGACCTGCCCGCCCGCCTCGCCTCGCCT
CCTCGTCTGCCTCCTCTCCTGCGCTTCAGTTTCCAGGCTAGGTTGCTGTTGTTGTTCACATGGATTCCTTTTTCCAAAGAGCTTTCGGCGACCCAATGTG
CTCGGAAGACAGTAATGTTGTCCAACAAGGAATTGATAAATGCCCATTCCTGAGGAACATCAACGAGCCTACAAGTTTTTCCTTGACATCCATTAATTTC
CCCGCTCCGGCAACCGGAGCCAAGGGTCCAATTTTTGAAGACGGGCCCAACTTTGACACGGCGTTTCGAGTTTTCCATGGCAGAGACGGGGTTGTTCCAC
TTTCAGAAGGAGCCTTTGCACATATTGAGAAGCCTCTGCCAAAGCCCACTCCTGAATTTAACCCCTTGGCAGCCAAAGCAGCTACCATCAGTCTCTCGGG
ATTCGGAGGCTTTTTCAGCTTCGGTGATTTCTCAAACAAGCGCAATAAGCAGAACTCCAACAAGAAGAATCCCAACAACCTCCCCCAGAATAAAGGCCAG
TCTAATAACAATCATGAAGCGATGAGCAATGACTGGCTGGAAAATGGTCAATGCCCTCTTGCAAAGTCATATAGAGCAATTGGTGGAGTCGTGCCTCTTG
TCGCAAAGCTGCTGACACCCCCAGCTGGTATGAAACTGACGTGCCCTCCTGCGATTGTTGCTGCCCGTGCAGCAATATCCCGCACGGCGTTTGCGAAGGG
GCTTCGCCCTCAGCCCCTACCGACAAAAGTAGTGGTGATCGCACTGCTCGGTATGGCAGCAAATGTTCCTCTTGGCATCTGGAGGGAGCACACTACAAAG
TTTTCAGTGCAGTGGTTTGCGGCGGTCCATGCTGCAGTGCCTTTCATAGGGATGCTGAGGAAGTCCATCCTGATGCCGAAGAGCGCCATGGCCCTTACCA
TAGCTGCCTCGATATTGGGTCAGACAATTGGTTCAAGAGCTGAACGTATCAGATTGAAGAGGGCAAAATTAGCAGCAGAGGGCCATGGCCATGAACATGC
TACCCGGATTGAAGCTCCGGTGAACCTGAAAACTGGGAGCTCTGGTGCTGTCCAGCTCTGGGACCCGCTTGGCCTCAGAGTCAAAGGCGCCGTGTCCCCA
GCCCTGGTTCCGACTGTCGGTGCCATGTATTGATGAGATGATCGTGCTTCATTGCGGCGGTTGTGAGAATTGTATCAGAGTTCCAGAAATTGTTTCTTGT
ATTCATTGTTGTTGTGTCTTGTAAAGGATTACTGGCTACATTGGATTCTTCTCCCCACTATCATGAGTTGGG
page-top