Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1589  (registered. 2012)
Contig Information
Length 809 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 4
Wh_SHC Shoot grown with cold treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115435978|ref|NP_001042747.1|| Os01g0279300 [Oryza sativa (japonica cultivar-group)]
Score 276
Evalue 2.00E-72
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1589
TGCAGGAATTCGGCACGAGGCTGAAACCCCCCACGCCATCATCGCCCCATCAACGCGCAGCTCGCGTAACATTTGCAGGCCCTCATCGTCCCCTCGAGGT
CTCCGTTTGCCATGGCGGACCAGCTCAGCGAGGAGCAGATTGGCGAGTTCAAGGAGGCCTTCAGCCTCTTCGACAAGGACGGCGATGGCAGCATCACCAC
CAAGGAGCTTGGAACCGTGATGCGCTCCCTTGGCCAGAACCCGACCGAGGCAGAGCTGCAGGACATGATCAACGAGGTGGATGCGGACGGCAACGGCACC
ATCGACTTCCCAGAGTTCCTGAACCTGATGGCCCGCAAGATGAAGGACACCGACTCAGAGGAGGAGCTCAAGGAGGCGTTCCGTGTGTTCGACAAGGACC
AGAACGGTTTCATCTCTGCAGCGGAGCTCCGCCAGGTGATGACCAACCTCGGGGAGAAGCTTTCCGAGGAGGTGGAGGAGATGGTCCGCGAGGCCGACGT
GGATGGCGACGGCCAGATCAACTACGACGAGTTCGTCAAGGTCATGATGGCCAAGTGAGGAACAACCACCCTCTGAAATAACCCTTTCTATTTTCGTCGA
ATAACGAACCGTCTGGCACTACTACTTCATAACAATTTTTACCTTATTATTATTACGTGCACGCTGCTGGTACTGACACTTGTTGGCTAGGTGTAGTCAC
TGAGGGGAGAAGGGCCAGATACTATTTTTTTTGTTCTCTTGGTCACGGACTTCTCCTGTACTTTGCTGGATTTGGTGTTTTTCTTGGCTGGGTTGCATCT
TGGTTCATG
page-top