Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15858  (registered. 2012)
Contig Information
Length 725 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 2
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_PCDAM Anther at meiosis 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242060704|ref|XP_002451641.1|| hypothetical protein SORBIDRAFT_04g005070 [Sorghum bicolor]
Score 149
Evalue 3.00E-34
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15858
GAACACAAAACGGTTGACACAAAATCAATGGAGTATACTGCAAGAACTTGTACTCGATTCGCTGAAAATGTTTTTAATCACAATGCATGCACTTCCAGTT
TGAAGTTGCTTATGACAAGACGCGGAGGAACGTAACAGTGGACTAGACAGTTCATTGCTGCCTTCCGACACAAAATAAACCAGCCATCAAATAGACATCA
ACTCCAGGTAGCCCATCAGTAGAAGAAAAACGGAGAGCACCATCCTGAATCAACCGTAGATAAGCTCTCCTGCGCGGGGCGGATCCGGATCTAGTGGCCG
CCGTGCTTCTCGAGGTGCTCGAGGTGGCGGCGCTCCTGGGGCAGGCCCACGAGGTACGAGAAGGCCATGCCGCCGAAGCAGACGTGGAAGAGCGGGTCAA
CCGAGCTGGTCTCGATGTACTTCTCGATGTAGCGGTCCACCGCCTGGTCGGTGCTCTTCTTCACGTTGGACCAGGTGAGGCGCGGCTTGAGGTACGCCGG
CACCTCGCGCACCTTCATCGCGCGGATCTCGTTGTACAGCGCACGCATCGCCATGGTCGCGACCTGGGAGATCTCCCTCTCTCTCTCCTCGTGCGCTTGG
AGTCTAGGGTTCGTTCGGTCGCTGGCTTCGGTGGGGTTGTTGCTGGACACCCACAAGAACCAAATCAATTTGCAGTCGGGCTTTCAGATGGATCCGTTAA
AGTGATGGAGCCGTTGGAGTCCGAC
page-top