Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15836  (registered. 2012)
Contig Information
Length 1508 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115479631|ref|NP_001063409.1|| Os09g0464000 [Oryza sativa (japonica cultivar-group)]
Score 445
Evalue 8.00E-123
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15836
ATTGCACAGTTTTGTTTATTTGAGTCACACATGCATCCAAAATAATTATACACTGACAAAACAAACATTACAGAGCTGTATCTTATTGTTACAATGATAC
ATGGACATTATACAGATGTTACAACACAAGGTCTGCCAAATGTGGCACCTTTATACATTGTTTCCTTTGACTATGGTTTTGCAGTTTTACTAGCCGCCGT
TTCACGATTCTAGACAGAAAACACATAGCAACTGGATTGAATTCGCTTTGTCCCGGCAGTTTACAAGCTTTGCTTTGGTGATAATGTATTGTTCGCTGTG
TCGAACTTTACTCCATTGCGGTTTTATTCCTCAGAGTATAAATAATGACTGTTCATTGATCAAGACCAGGTAGACCTGTTCTTTATAGCATACTTGCTGC
CACCTTCCAGCCCTGGACGGTACACTAATGTCCACTTCTCAAATGTGCAATCAATAAAGTTATAGTATCCCCCGTGAAGGTTCAAATTTCCTTCCTTCAC
CCTTTCCTCTATCCAAGGGTATGTTAACAAGTTCAACAGTGAGCTATTAATTGATTCCTTTTCACAATGTCTACATTGTGATTCGAAACTCAAATTTCCA
GCTGCTGCTTCTGTGCTTAATCTTGCACTCTTGCCAAGTGAGACCCAGTCTCTGATAAAGGTTCTAGAGCTTCGATCGTCTTTCTTACTTTTCATACTCA
TTAGTGCTTGGATGCCACCACAACGACTATGACCTACCACTAACACATTCGGTACCTGAAGTGAGTTGACAGCAAACTCTAGTGCCGCAGTAGTCTCTGA
AGCTCCATGCTCGTATGGTGGTACCAAATTTGCCACATTACGGACAGTGAATGCATCACCAGGCTGAAGCCCCAAAATACTGGTAGGGCAGACCCTGGAG
TCAGCACAAGCAACCACCATGAACTCTGGTGTTTGCTGCTCAGCAAGTTTTTGATAATTGGTAAAATTTTCCACGTAGTTTCGTTGCTTGAAGTCTGTGA
ACCTTGCTTTCAGTTGACTGAATGGATCATATCCCCCATCTACCTCATCTACAGTATCATGTTTAAAATCTAAAAGTTGCCGGGTTAAGCTAGAATGATC
TCCTGAGGCCTTTGTAGTACATGAGAATTCACTCCGGCGAGGTCGACGGCGATGATCATCCCACACGGCGGCCCTCTGCTGGTGCTCTCTGTCGTCGTCG
ACAGCAGGCGGCCTTTGTTGCCACGTTGCCGGCGCCGGCGCAGGTGATCGAGCCGCCACCGCAGACGAGGCTGCTGCGCGTGTGGCGGCAGCCAAGCGGC
GAGCTGCTGATCGCAAGGACCACGGGAGCATAGAACTTCAGCAGGTTCCCGGCGGAAATGGCCCCCTTAGCTGGAGGCCTGGAGCGACATGTGGGTAGAA
AAACCAGCAACGAGTGGTGCGATGCGGTTCCGTGCGGTACAGTACGTGCTACGGATGGATGGATGGGTCTAGCAGGCCGGAGCGGACAGGTAGACGAAAG
GAACGGGT
page-top