Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15830  (registered. 2012)
Contig Information
Length 1001 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_EM Dormant seed with water absorption 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 7
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125531097|gb|EAY77662.1|| hypothetical protein OsI_32701 [Oryza sativa Indica Group]
Score 398
Evalue 5.00E-109
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15830
ACCGCTTCGAGAAGCGTCGCCACCAAGGCACCCAGACCCCAGACCTCCTCCTCCCGGGAATCGGAACCGCGTCACATTCGTCGCTCCCCTGATCCATCCG
GCGACGCGGCGGAGCAAGGAAGGAACCAAGGCTCGAGCAGCGGGCGGCCGGAGAGATGGCGGAGAACCCGCAGCTGTTCGGGAACGGGATGCCCGTGCCC
TTCCACGGCGAGATGTTCGTCCTCGCCCGCGACGGCGTCGAGTTCCACGTCGACAAGATCCCCTCGGCGCCCGGCGGTCACGCAAAAACAAAGGGCACCA
TATACCTTTCTAACATAAGGATGGTGTTTGTCGCCGCCAAGCCTGTTGGGAACTTCTTTGCCTTTGATATGCCTCTGCTGTACGTGCACGGTGAGAAGTT
CAACCAACCGATATTTCACTGCAACAATATTTCTGGATTCGTTGAGCCGGTTGTTCCAGAAAGCCAGAACAGGGCTCTGTACTCGACCCACACCTTCAAG
ATCTTGTTCAAGGAAGGTGGATGTGGTACCTTTGTGCCACTCTTCCTGAACCTGATCACATCAGTGCGGCGCTACAATCAGTTTGAAGCCCAGCCCGCTA
CTGTGCCCCGTGTGGACCCCATGCAGGCAGCGCAAACTCCTGTCGACGACATGATGCGCCATGCGTACGTCGATCCACATGATCCTACCAAGATCTTCCT
CCAGCAGCCCGCAGCGGAATCCCAGCTGAGGAGGAGAAACTACCACGGCCCCGCTGAGAATGTGTACTGATGCTTTGGCCTGATTGCAAAGTGCATGTGT
TTTCGGTGATCTATGTGGCGCACACGAGCAATATATCTGTTTGGTGTCAGGATGTGATGGAAGTATAGTAGTATGATTGTGTGTTCCACTGTTGGATTCA
ATCCAGATCTAAGTATAATAATGTACATACAAGGTGATGTGCTGGATTATATGTTGCTGATCTCGTCGTATAGAGTTATAAAACTGGTCTGAAAAAAAAA
A
page-top