Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15828  (registered. 2012)
Contig Information
Length 896 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_DPA20 Seed DPA20 1
Wh_SHDr Shoot grown with dessication 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|283806355|dbj|BAI66419.1|| aminotransferase [Triticum aestivum]
Score 444
Evalue 8.00E-123
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15828
GTGGGCAAGCTTATAAACGGCTTTATTTGGCAGATTATCTTTACAGGTAAGAATGTACCAAATCTATCTTGTCTGCAATCAAGTCGTCAATCACCATTGC
TCGCACATCAAGAACAGTGTCCGTTCCGGTGCGTTATTACCACCTGACAGCGAGGGGTTATTCTGTACACATCCGAGACCATCGGCCGACATTACCATCA
TCGTTGTGCTGCATCTTGTCTAGTTTTTCTTCGATTTGAGCTCCGCCACTCTCTCCTCCGTTGCCTTCATAGCTTCTCCGTATATGCTCACCAGCTCATC
AACTTCGCCGGGGGTCATTGTCAAAGGCGGTGACATCATAATGCTGTCGCCGGCAACCCTAACCAGCATGCCACGCTTCTGGCACTCCTGTCCGAATATA
GCACCAACACCCCATTCAGCAGGGAATGGGTCATCTCGTGATTTATTATTGGCGAACTCAGTTCCGAGTATCAATCCTACACCACGGATCTCCCCAACAA
TTGGGCTTCCTGCAAAGGCCTTCGTTCCCTCCTGGAAGCGTGGAGCGATTTGCTTCACATGATCAGGAATATTCCTTTCCCGATAGATTTTCAACGCTTC
AATGGCAACAGCGCAAGCAACTGGATGGCCAGAGTATGTAAAGCCATGAGCAAATGAACCTAGCTTATTGCTCTGAGAATCAACCACAGCTGCTATTTCG
GGGCTAACAAGAGTTGCTCCAATGGGCACATACGCAGACGAAAGAGCCTTGGCCAAGGTGACTAAATCTGGCTTGATGTTATACATATCAGATCCGAACA
TGGTTCCCAACCTTCCAAATGCGGTAATGACCTCATCTACTATGAAAAGGATGTCATACTTCTTAACCACAGCTTGAACCTTATCAAAATAAGTCT
page-top