Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15802  (registered. 2012)
Contig Information
Length 871 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 1
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|119638443|gb|ABL85034.1|| ribosomal subunit 8E protein [Brachypodium sylvaticum]
Score 285
Evalue 4.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15802
ACAACCAAAACAGGAAAAACATTCTCAGTTCAACCTAGGACTCGAACAGTTTACAGAAAATGGTGTTCAGTATGTCTGCAAACATGACATGGACGCAACA
TCTAAGAAAATCCAACAAGTAACATGCAGCAGCTCTTCAGCCTAAGCTGTGGCACCCTTGCCCTTCTTCTTCTGGAGCTTCCTCATGTAGAACTCCAGCT
CCTTGCCCTCCAGGATGTACCCATCAGCTCTGCCACACTGTCCAGGGCGAGACGAAATGCAGGCCAGCAGCCTTCCACCGCTGAACTGCTCCTCAATGTG
AGAGTCCAGTGTACGTCCCTGCTGGCGCTTCTCAAGCTTCCTCTGGACATTGTTGCTCTTCTTTGCTTCCTCTGTGGCAGCAGCAGCAACCTCAGACTCT
TGTCCCTCAGCAGCATCCTTCTTGGCAGCTGCAGCAGCTTTCTTCTTCCTACCGATTTCCACTCCATAATGAGTCAGGTACCACTGCTTGAAAGGGGCAG
CATCAACTTGCACAATGGCATTCTTGACAAGGGTCTGAGTCCTCACAAGCTCATTGTTTGACGAATTGTAAACCACATCCAGGAGACGGGTCTTGCGGGT
CACCGCCTCACTACCCCATGAGAAGTTACGTGTCCAGACGGAGAGCCCTCCACTTCACGTTACCTCCACGAACACGGACCCTCCTCACTGTCTTGTTGCT
CGAAAGCTTAGTGTTGGCTGGCTGGCGGCCGAGCTCATACTTTCGCTTCTTCCTCCACGCCTTCTGCTTCCCACCGGTGGCCCGGCGCTTGTGCATGGAG
TCACGCGAGATACCCATGGTGGCGTCGGTGGCTTGGCTCCGCTGCTGCTTCGCCTCCTATGCGCGCGCCGC
page-top