Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15793  (registered. 2012)
Contig Information
Length 1292 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57635157|gb|AAW52720.1|| peroxidase 6 [Triticum monococcum]
Score 570
Evalue 2.00E-160
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15793
TAAAAGACCATATACCTTGGGAGATTACATGATGGAGGAGGTATTTTACAATCTTGGAGGTGGAGGGTCCGGTTACTCACCTCTGCACCGTACATATCCC
TCCGTAGCGATTTAAACGCTCTTATATTTCTTTATGGAGGGAGTACAAATTACTATCCGAGCCAAACGGTTTTATTCTGTCATGCATGCATGCGTACTTA
CATGTTGCGCATGTAGGAGTACTTCACACTGTAGCATATATCCATTTCTCCAACAAGTATTTCCGGACGGAGGGAGTACATAGGATGCGTAGATGGATGT
TGGATCAGCTGTTGACGACCCTGCAGTTACGCCTAATCTGGGTGGGCGTTCCGCTGGGCGGGGTGAGGCTCGCCATCTTGATCATGGCCGTCACCAAGTC
GGAGGCGAAGAGCGCCGGGTTGGCGGCGTACTGGCGCACCAGCGCATCCTGGGAGCCGCCGTTGAAGAGCACCTGGTCGGAGTTGAGCAGGCCGCGCTTG
GCCACGAGGTTGCGATAGTAGGCGTTGTCGAAGAGGAGCGGCGTCTGCACGTCTAATGGCGCGAGGTTGGTGTCGCCGTTAGGGGCCTGGGCGGGGCAGG
CGCCCTTGCGCAGCGCGGCAAACGCCGGGTCGATGTTGGTGCTGTTGTAGATGTGGTCGCGGAAGTTGAGGCACTGCGAGAAGCCGATGGTGTGGGTGCC
GGACAACGCCGTGAGGTCCCGCGGGCTCAGCTGCTTCTTGGCGAACGCGGCGATGAGCTGGTCCAGGTTTAAGCTGGGCCCCGGGAGGTCGCTGTTCGCC
TGAGTCAGGCTGGCCGTCGTCGAGTCCCGGTGGCCGAGCGGCACCGCCCAGCTGGGCCCACCTAGCAGAAAGACGCCGTCCCGTGCTGCGAGGGCGGTGA
TGTCGGCGCAGGAGACGACGCCCGGGCAGGCCAGCTCCACGTTCCTCTTGATCTCATCGATCACCTCGTAGCCCCGCACTGAGTTCACGTTCGGGAAGGC
CGTCTTCTCGCCCACGAAGCTACCCACGTCATCCAAGAGAATGGACCCGTCGCAGCCTTGAACAAAGCAGTCATGGAAGTGGAGCCTAAGGAGGGACGCC
CCCATTCGGCGCTCGGCGAGGAGAGCCTTGATCATGGTGGCGCGCACGACAAGCTCAAGCGACGGGCAGCTCTTCGAGTAGAATGATGGCGAGAGCTGCC
CATAGGCCGCCGAGGAGAGGAGGAAGAGGGCAAGCAAGCAATGCCATGTCCGGCAGCTGGAGCTGGAAGCCATGGCTCACAAATAGGCTCAG
page-top