Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15792  (registered. 2012)
Contig Information
Length 1916 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_CSEC Callus 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XB Root 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218187646|gb|EEC70073.1|| hypothetical protein OsI_00686 [Oryza sativa Indica Group]
Score 1108
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15792
TATTACCGCACAATCACGGGCAGGTAATCTGAGCAACTATTTGGGCATATGATCATCCAAATTTTGATCGATTGAAACAACACATACTATAATAGTCATC
ACAAGCCCAGTATGCAAAACAAAAACAAAAAGGGCCTCTTGGCCATTTTCATGTTGTATGTCATGACTATGTTTTCTCCCATTAGCGTCTCTCTGACCAA
GAAAAAACGGAGCTTCTTCACTAAATTTGCAGTCACTTGGGTCCAGCCTTCCCATAAGAGTCGCGCAGGGTCACAGTCCTGTTGAACACAAGCTTCTCGG
GCGTCGAGTCCGTGTCCACAGCAAAGTAGCCGAGCCGCTCAAACTGGAACTTGTCGCCCAGAACTGCAGTCGCGAGTGACGGTACAGCATATGCATCCTT
TACAACCTCTTTCGAGTGCGGGTTCAGATCGCCCAGCCAATCTTCCAATTCGGCAGGATTCTCCGATAGGAATAATTTCTCAAACAATCTTATTTCAACC
TTTAACGGCTCAACTCCAGGTGCTGGCTGGGCAACCCAGTGCAGAACACCCTTAGGTTTAGAGGTCTTTGAGGGGTCATACTCGGCTCGAATTTCAACAA
TATCATCTGGATTATCACCATAAATAACCTCTGTGCATTTTATCGGGAATGCATACCTCAGCAGGGCAGATTTACCAGGAGCCAGTCCATAGTAATCTTT
CGAGTCCTTCACGCGAAAATCAGTTTTTTCAATGTAGACGGTTTTTGAGAAAGGAACCTTGTAGTAGGACGAAGCTTCATCAGCAGGAGCATCAGGCCAC
TTTTTTCCATCAAGGTCTATGACTTTTCCATCTTCCAAGTTAGTTATTACAACCTTTAAAGGATGCAAAACCACCATGGTTCGAGAAGCTGTTTTATTCA
GTTCTTCTCTGATATGATATTCAAGACGGTCAACACGAATTAAGCTATTATCACTTCTCGTTATCCCAATTCCACGGATAAATGAATTGATCGCAGTTGC
TGATACTCCTCGTCGCCTCAGTCCTGCCAAAGTCAACAAACGAGGATCATCCCACCCATCTACCCACTTCTCTGTCACAAGCCGATTCAACTTTCTTTTG
GACATCATAGTATGTGATATGTTTAGCCTTGAATACTCCCAAACATATGGCTGGTACAAGCCCAAGGCAACAAGTAGCCAGTAGTATGACGGGCGACGAA
TGTCGAACTCGAGCGTGCACAAAGAATGTGTAATGTTTTCAAGTGAATCCACCATGCAATGAGCATAGTCATAGCTTGGATAGATACACCATTTGTCGCC
AGCATGCGGATGAGGAGTGAATTTTATTCTATATGCTATTAAATCAGACATGTTCTTGTTATCATTCTGCATGTCCTGCTTCATTCGGAGAGTTGCTGCA
CCTTCAGCAATCAACCCGCGTCGCATGTCTTCAAATAACTGCAAAGACTCTTCAATGGGCCTATCCCTCCATGGACTATCCATCTTCTTTTCCCTGTATT
CCTTGATTTGTTCTGCAGTCTGGTGATCCACATAGGCTAGCCCTTTCCGTATTAACTCAACTGCATGCTCATATAAATCTTGGAAATAATCACTTGTATA
TGTAACTTTATAGGGCTCCCATCCCATCCACTTGACTATCTCCTGAATGTGGTCTATATATTCTTTCTTTTCAGCTTCTGGATTTGTGTCATCAAACCTG
AGATAACAGTGACCATTTCGCTCTTTAGCCAATCCAAAATCAATAAACATAGCCTTAGCATGACCGATATGAAGATATCCATTAGGTTCTGGCGGGAAAC
GGGTCATCACTTTTCCACCAGTTGCCTTAAGATGTTTCTCTAATATCTCCTTCGTGTTATGTGCCCTCCATATGTTCCCGTCGCTGAAGAATATTTCTGT
ATGAACCTTATTGTTT
page-top