Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15752  (registered. 2012)
Contig Information
Length 712 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_DPA20 Seed DPA20 1
Wh_KMP Shoot grown under continuous light 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222629653|gb|EEE61785.1|| hypothetical protein OsJ_16357 [Oryza sativa Japonica Group]
Score 295
Evalue 3.00E-78
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15752
GAATTTCTTCAGGCCAGAGGCACAAGACATCCTGCACTGCACGAGCAGCTTCGCTCCACATGAACACACCTGTCCAGGCTACGCAAACGCCATCGTCACA
AGGAGTTTCACATAGCCACTACACATGTCCATAACCACGGAGGACCTTAACCAGCTACATGTCCATAAGTCACCATAGATAGATAGACAGATAACCTATA
TACACACACCACGAGCCAACGACGACGAAGCTCGGTCTAGCAGACCTCGGTCTGGAACTTGAGGCAGATGCCCATGCTGAAGAGCTCCTGGTAGAGCAGC
TTGGCGCCATAGGGGACGGCGATCTTGACAATGTTCTCCGAGGACTTGCAGAACCCGCAGTAGGGGCCCCGGATCTTCCGCCCGCCCGAGACGGGCCGCA
TGATGACGTTCGCCCCCCGCTCGCACGTCTGGCAGATGCGCATCTCCGAGAAGTCGCTCAGCGTGAAGAGCCGCTCGTGGAGGTTGGCGGCCGCGCCGTG
GGCCAGCAGGCAGTCGCGCTCCATCTCCCCGAACTTGACCCCGCCGAACCTCTTCCTGTCAGCGACGGGCTGCCTCGTGAGCGGGTGCACCGGCCCCGTG
TTGCGGAACTTCACCTTGTCCTCGGCCATGTGGATCAGCCTCTGGTAGAAGTTGGGGCCTGCGAAGATCAGTTGCTGCATCCTTTTGCCGGTTTGGCCAT
TGAGAACGCTTT
page-top