Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15751  (registered. 2012)
Contig Information
Length 872 bp
Clones alternative view 58 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_VHS Shoot with heat shock treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 8
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 6
WH_XN Leaves, plant was grown at constant 23Ž 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115453089|ref|NP_001050145.1|| Os03g0358100 [Oryza sativa (japonica cultivar-group)]
Score 319
Evalue 2.00E-85
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15751
GCACGAGGGATAAAATTCGACAGAGGATTCGGGAGGACTTCCGCCGTCCGGGAGGCGAAGAGAGGGCGAGATGGGGGCGTCCGAATCTGTGCTGGAGACC
TCCGTACACGAATTCACCGTTAAGGATTGCAACGGCAAGGAGGTGTGCCTGGACACGTACAAGGGGAAGGTCCTCCTCATCGTCAACGTCGCCTCCAAAT
GCGGGTTCACGGAGACTAATTACACGCAGCTGACGGAGCTTTATCAGAAGTACAGGGAGAAAGACTTTGAGATATTAGCATTCCCCTGCAACCAGTTCTT
GCGACAAGAGCCAGGCAGTGACCAGCAGATCCAAGACTTTGCATGCACAAGATTCAAAGCTGAATATCCAGTTTTTCAGAAGGTGCGTGTAAATGGCCCA
GATGCTGCGCCGCTTTACAAGTTTCTGAAAGCTAACAAACCTGGTTTGTTTGGTTCAAGAATCAAGTGGAACTTTACCAAGTTTCTTGTTGACAAGAATG
GAAAAGTAATCAACAGATACGCAACTGCTACCACACCATTTTCATTCGAGAAAGACATCCAGAAGGCACTTGAGGAGGAACCCTCTGACTCGCAGACAAA
AAAAGAGGAGGAATCCTCCGACTCGCAGAAGTAGGCACTTGCAAAGTATCCCCGTTGTAATATCTAGACCAATCTCTGCCAGTAAATTAATGTGATATTT
CCCCTGGTTTGATCTTTGTTCTTGTATTTGTGACTTCCGCTTATGCAACTAGAGGTTGTGTAGGTACCAATTATTTATCTGCACCTCTCGTGGTTCTCTT
TTGGGTGCTTTTGTGATGAACTGGAATTGTATGCAGTTTATGGTAGTTCTGTATTTGGACTCAAAAAAAAAA
page-top