Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15750  (registered. 2012)
Contig Information
Length 2440 bp
Clones alternative view 59 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 6
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 11
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 7
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23 5
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|53680379|gb|AAU89392.1|| glutamine-dependent asparagine synthetase [Triticum aestivum]
Score 1182
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15750
TTCCCTAACATAGTACTAGAGCCTAGTTTTTTNNNNNNNTAGCAACTAGTGCTCTCCCCGATCAAATCTCTCGCAACGCCGCCGCTGTTGTCTTCTTCCC
CGGCCCGTGTTGCTGCTTTTCTCCCACCTGCCCGCCTCATCTTCCCAAGCCGCAGGAGCTCTTCCCGCTCGTGAGCTATCTGCTGCAGATCGATCGGCTG
GTTGCGGCTGCCTCGGTCAACGCCGCTGGTTTTTCGCCGCGTCTGGCCGGATCCGGCCGCCATCGCCGGTCTTCGCTGGATCCAGCCGCTCCTTGCTGGC
CTTCGCCGTCCCTCGCCGGATCTGGCCGCCCCTTGCCGGATCCCGCCACCTCCGGCTGGATTCGTTCCGCGAGCGTTGGTTGTGGCCGCCTACATCGGCC
TCGTGCCGAATTCGGCACGAGGGAGAGATCTTCTAGCTACATACTGTTGCCGTCGATCCAGGAAAATGTGCGGCATACTGGCGGTGCTGGGCTGCGCTGA
TGACACCCAGGGGAAGAGAGTGCGCGTGCTCGAGCTCTCGCGCAGGCTCAAGCACCGCGGCCCCGACTGGAGCGGCATGCACCAGGTTGGCGACTGCTAC
CTCTCCCACCAGCGCCTCGCCATTATCGACCCTGCCTCTGGCGACCAGCCGCTCTACAACGAGGACAAGTCCATCGTCGTCACAGTGAATGGAGAGATCT
ACAACCATGAACAGCTCCGGGCGCAGCTCTCCTCCCACACGTTCAGGACAGGCAGCGACTGCGAGGTCATCGCACACCTGTACGAGGAGCATGGGGAGAA
CTTCATCGACATGCTGGATGGTGTCTTCTCCTTCGTCTTGCTCGATACACGCGACAACAGCTTCATTGCTGCACGTGATGCCATTGGCGTCACACCCCTC
TATATTGGCTGGGGAATTGATGGGTCGGTATGGATATCATCAGAGGTGAAGGGCCTGAATGATGATTGTGAGCACTTTGAGATCTTTCCTCCTGGCCATC
TCTACTCCAGCAAGCAGGGAGGCTTCAAGAGATGGTACAACCCACCTTGGTTCTCCGAGGTCATTCCTTCAGTGCCATATGACCCACTTGCTCTCAGGAA
GGCTTTCGAAAAGGCTGTCATCAAGAGGCTTATGACGGACGTTCCATTCGGTGTTCTACTCTCTGGTGGCCTTGACTCATCATTGGTTGCAGCCGTTACA
GTTCGTCACCTGGCAGGAACAAAGGCTGCAAAGCGCTGGGGGACTAAGCTTCACTCTTTTTGTGTCGGACTTGAGGGGTCACCTGATCTGAAGGCTGCAA
AGGAGGTAGCCAATTACCTGGGCACCATGCACCATGAGTTCACCTTCACTGTTCAGGACGGCATTGATGCAATTGAGGATGTGATTTATCACACCGAAAC
ATATGATGTGACGACAATCAGGGCAAGCACGCCAATGTTCCTGATGTCACGCAAGATCAAGTCACTTGGGGTCAAGATGGTCATCTCTGGTGAGGGTTCC
GATGAGATTTTCGGAGGGTACCTCTACTTCCACAAGGCACCCAACAAAGAGGAGCTCCACCGTGAGACATGTCAAAAGATCAAAGCTCTGCATCAGTACG
ATTGCTTGAGGGCCAACAAGGCAACATCTGCATGGGGCCTCGAAGCACGTGTGCCATTCTTGGACAAGGAGTTTATCAATGAGGCAATGAGCATTGATCC
TGAGTGGAAGATGATCCGGCCTGATCTTGGAAGAATTGAGAAATGGATGCTGAGGAAAGCATTTGATGACGAGGAGCAACCATTCCTGCCGAAGCACATT
CTGTACAGGCAGAAAGAGCAGTTCAGTGATGGTGTTGGCTACAGCTGGATTGATGGCCTAAAGGCTCACGCAGAATCAAATGTAAAAACATTGCTGCCTC
TCATGTTCAACACATCACTGTTATGCATAAAATTGTAGTAAAAAATCAGTTATTTGTAAAATGGTATAATTACACGAGATGTAAAATTATTAATGCAGGT
GACAGATAAGATGATGTCAAATGCAAAGTTCATCTACCCACACAACACCCCGACTACAAAAGAGGCCTACTGTTACAGGATGATATTTGAGAGGTTCTTC
CCCCAGAACTCGGCGATCCTGACGGTGCCAGGTGGGCCAAGCGTTGCATGCAGCACGGCGAAGGCGGTAGAGTGGGATGCCCAGTGGTCAGGGAACCTGG
ATCCCTCAGGGAGAGCAGCACTTGGAGTCCATCTCTCGGCCTATGAACAGGAGCATCTCCCAGCAACCATCATGGCAGGAACCAGCAAGAAGCCAAGGAT
GATCGAGGTTGCGGCGCCTGGTGTCGCAATTGAGAGTTGATGGTGTCCTGTCCTGCTTGCCGTTTCTGATAAGAAATAAGATGTACCTGGTCTTGCCATT
AGAGTGGTGCAGACCTAAGGTTTGAGTGAAGATTGTGCAT
page-top