Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15723  (registered. 2012)
Contig Information
Length 1020 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_EM Dormant seed with water absorption 1
Wh_OKCS Seed DPA5 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XF Seedling, infected with leaf rust 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115465623|ref|NP_001056411.1|| Os05g0578000 [Oryza sativa (japonica cultivar-group)]
Score 270
Evalue 2.00E-70
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15723
ACCCCAGCAGTAGGGATGTGTCAACAAGTGAAGAATGCCAATGATAAGTACATAATGTAGGTGCTCATTTCCAGCAAGAATCCAATCCCAGCTTCCCAAG
AATGCTGCTGACCCCCTAAACTAAGCTAGTTTCTGATAATAACGGAAGATGCAACAATGTGGTGCTGGAATCTGAAGCAGCATCAGGCCGACGCTGATTC
ACATCATGTCCTGATCCCACCGCCGTTCGTCTATGCATTTCCAGAGTTACTGCTTCGGCGAGGCGGCAACGTCATCCACGGGGGCTTCAGATCCTGTAGC
TGGCTCTGCCGTCAGCATCAAGTCCCCGTGACCGGAGCTGTTGTTTGATCCCGTGGCCTGGCTGGTGCTATCGGTTCGAACTCCTGACGACGATTCGCTT
GGGTCGCTTGAGTGAACCTTCAGGTCCCAACCGGAACTTTGTTGGCCTTGCTTCTCCCATGGCTTGGGCTTGGGTGCCATACTGGGTTTCGAGATTGGCT
GATCAGGGTTTGGTGGCTCATCATTAATATCCTGGATATCATCTGGCCGCTCTCCCCTCTGTATCATTTCCATGACCTCCATATATGATTTTGGGTGCCG
GGGCGCCACAGGGGTCACAGTTTCAGGGTCAGGAGCCCCTGGAGGTTTGCAAGCATCTGAACTTGCAGAGTTTGAAGGCGGGCTAAGAAGCAAACGCCGA
AACGCTTCTTCGATTTCGTCCATGGTGAGCCCTTTATTTTCCAGGAAGGAACGCCTCTGGACATCGGAAGATGCCACGACTTTGGGGTGACTCAGAAAAC
TAACGGCACTCTGGACCAGTTCCTCCCTCACCGGTTCAGAGGTCGCAACAGCCGCTTCTCCTTTCATGTCCTCCTGCTCTTTCGTGTCTTGCGTCGTACT
AGTACCATGAGCAGCTTCTGAGATACCTGGATCCCGCGCCTCGTCGGCCGGGGACGACGCCGGCGGATCCGCCATTAGAGCAGCAGCTTCGCCGAGGATA
AGATCGGGGGAAGGGGAAGG
page-top