Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15677  (registered. 2012)
Contig Information
Length 763 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 4
Wh_EM Dormant seed with water absorption 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XA Root 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115489474|ref|NP_001067224.1|| Os12g0605400 [Oryza sativa (japonica cultivar-group)]
Score 284
Evalue 6.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15677
CACCAAAGGGGAACGAGCGCCGCCGAGCGAGCACGCACGCACGCCCGCCTCCCCCCACCGGAGCACGCGCGCCGCCCCGAAATCCCCTGTCGCATCCGTC
GGGCGGTCTCCTCCCCGTGCTCCTCACTTTTCTGGAATGGCGTCGAGCGGTGACGCAGCCGGAGTTGTCGTGCCGAGGAACTTTAGACTGCTGGAAGAGC
TTGAGAGAGGAGAGAAGGGTATTGGGGATGGAACAGTTAGCTATGGAATGGATGACGCAGATGATATCTACATGCGCTCCTGGACAGGAACAATAATTGG
TCCCCACAACACTGTCCATGAGGGCCGGATTTATCAGTTGAAGCTTTTCTGTGACAAGGACTATCCCGACAGGCCACCGACTGTTAGGTTTCACTCAAGA
ATCAACATGACCTGTGTAAATGCCGAGACTGGATTGGTGGACCAAAGGAAGTTTAGCCTGCTGTCCAACTGGCGCCGTGAGTACACAATGGAGAACATCT
TGATACAGCTTAAGAAAGAGATGGCGACATCACACAACCGGAAATTAGTGCAGCCTCCGGAGGGGACGTTCTACTGAAAGAACACTTGTCGCGTAGAACG
TGTCATTCCCAAGAACCCTCGCGGTTCTCATTTTAGATATCGCATAAGATCGCAACATTTGGTGCAAACGATTATGTATAACTTTGACGGTGTCCTTCAC
ATGGTTCTTGTGTGTCTTGTCTTGTTATATCTCCTGGGTAAGCCTGTGTTGTAATGATACGCT
page-top