Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15633  (registered. 2012)
Contig Information
Length 608 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig15633
AAAGTAAACACCCTTCTATTCTAAGAAAGCCATATCCGCGGGTATACACAACTACCCACTCTCAGTAGTAGTACAGCCTTTTTCCTTTTCGTCGCGAAGA
TCAATAGACGACAGCACAATTCCGGTAGTACTACATGCTCGTAAGTTCACTAAAAATGCTCATTCTTATTTACCGAAATCAAAGATATTCCAATCACTTC
ATTGGTTCTCCAAAGTAAAAACAGGGGTTCCACCAGGCGATTTACTCAACCGGGGAACATTTAGCGCACACCACCATTTTACCAATCACACTGCTTTCTC
GATTCGGTGTGCTCTGCTACTCTTGCTTAGTAGCAGGCTCCTTGGCCGGGATCTCGTGCACCACCTCGATCGGCTTGATCGTCCCCTGCCCCTCCTCCTG
CCCCGCCGACTGCCTCACCTCCACCGTCTGCACCGTCTTTGTCACCGTCGGCTCGCTGCCTGCCGCCGCCGCCGGGGCGCTGTTCTCCGGCGCGGGTGCG
TCCTTGGGTGAGCTGGTGTCGGTCGTCGACATGCCGCTGATCTCGCGGAGGAAAGATGGATGGAGAGTGGATGGCTGCTCAAGAGGAATTCGGCACGAGG
CCTCGTGC
page-top