Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15627  (registered. 2012)
Contig Information
Length 1256 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115444133|ref|NP_001045846.1|| Os02g0139500 [Oryza sativa (japonica cultivar-group)]
Score 306
Evalue 2.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15627
AGAGATGTGGAGGCTAAAGATCGCGGAGGGCAGCGGCAACCCACTGCTGCGCACCACCAACGGCCACGTCGGCCGGCAGGTATGGGAGTTCGATCCTGCC
GCGGATGACCCCGACGAGGTCGCCGCCGTTGATGCCGCCCGCCGCGACTTCACCAGCCGCCGGCACCAGATGAAGAACAGCTCCGACCTCCTCATGCGCA
TGCAGCTCTCTAAGTCAAACAATCTCAAGATGAACCTTCCTCCCATCAAGCTGGAACAACATGGGTATCACACAGAAGAAGACGATGTCTTGATATCTTT
GAGGAGGGCAATCAACCGATGTTCCACTCTCCAGGCACATGATGGCCATTGGCCGGGGGATTACGCTGGCACTTTATTTCTCTTGCCCAGCTTGGTACTT
TCTCCTCGTATCTAACAACAATTTTCTAGACCTTTTCTTATGATTTCAATATGTATGAAATAAAGTCAAAATAATCTATTTCCATCTCCATAAGTAGATG
TTTGGTTTTCCATGTTTTGATTTGCATCGACCATTTCTCTCAGATTGTAGCACTGCATGTGACTGGAGCACTAACTACTGTGTTGACATCTGAACATCAG
AAAGAGATTCGGCGGTATCTCTACAATCATCAGGCACGTATACATGCCTACTGACATGATTAAAAAAAATGGACAAGTATTTGCTGATATTATTGTTGAA
GTATAGAATGAAGACGGGGGTTGGGGACTGCATATTGAGGGAACAAGCACAATGTTCTGTACTGTCATGAACTATGTTGCTTTGAGATTGCTTGGGGAGG
GGCTGGATTCATGCGGAGCCATGCTACAAGCTCGGAGTTGGATCTTGGATCATGGAGGAGCAACTTTAACACCATCGTGGGGAAAATTCTTTCTTTCGGT
CCTTGGGGTATATGACTGGTCCGGGAACAACCCATTGCCACCAGAACTATGGATGATGCCTTATTTCTTGCCTATTCATCCAGGGCGCATGTGGTGTAAT
TGTCGGTTGGTATATTTGCCCATGTCATACCTATACGGGAAGAGGTTTGTGGGTGCTACTACATCAATTGTACTAGACTTGAGGAAAGAGCTCTACAATG
TCCCGTATAATGAGATTAACTGGGACAAGGCTCGCAATGGGTGTGCCAAGGAAGATCTTTATTATCCCCATTCACCACTACAGAATATTGTATGGGCCAC
TCTCAAGAAAATTGGTGAACCGGTTCTTATGCACTGGCCTGGCAGCAATTTGCGAA
page-top