Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15605  (registered. 2012)
Contig Information
Length 1140 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115450022|ref|NP_001048612.1|| Os02g0830100 [Oryza sativa (japonica cultivar-group)]
Score 681
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15605
CCGAGAAAGTGAAGTTCTACCTGACGCTGGGGCAGAGCAAGCCAATCTACGAGGCCTTCAACGCCATCAGGAATTCTTCAGACTGGGACAGCCTCAGCGA
CGCCCGCAAGCGTGTCGTCGAAGGCCAAATAAAGGATGCTGTTCTTGGTGGAGTTGCGCTTGAGGATGAGCAGAGGGAAAAATTCAATCAAATCCAACAA
GAACTTGAAAAGCTGTCAGAGAAGTTCAGTGAAAATGTGTTGGATGCAACAAAGAAATTTGAGAAATTGATTACTGATAAGAAAGAAATCGATGGTTTAC
CTGCCTCAGCTCTTGGCTTAGCAGCACAGACTGCTGTTTCAAAGGGTCATGAAAATGCTTCAGCTGAAAATGGACCTTGGATGATCACACTAGACGCACC
AAGCTTCATGGCTGTCATGCAACATGCCAAGAACAGGGCTCTCCGTGAAGAAGTATATCGCGCTTATCTAACCCGTGCATCAAGCGGCGATCTTGATAAC
ACCGATATCATAAGTCAGATTTTGAAGTTGAGGCTAGAGAAGGCTAAACTACTTGGCTACAAGAACTTTGCTGAGGTAAGCATGGCTCGGAAAATGGCAA
CTGTTGACCGGGTGCAAGAGCTTCTTGAGAAAATCCGTGCTGCTTCCTGGGATCATGCTGTCCAAGATATGGAAGACCTAAAAGCCTTTGTGAAAGATTC
TGGTTCTGCAGAAGCCAATGATCTAGCACACTGGGATCTTAACTTCTGGAGTGAACGACTGCGGGAATCTAAATATGACATCGATGAGGAAGGGCTGCGC
CCTTACTTTGCACTGCCCAAGGTTATGGATGGCCTCTTCAGTCTTGCGAATAAGCTCTTTGGAATAACCGTTGAAGCTGCAGATGGATTGGCTCCTGTTT
GGAACAGTGACGTCAAATTTTATTGTGTCAAAGATTCTTCCAATAGCCCCGTTGCTTATTTTTACTTCGACCCATATTCAAGACCATCTGAAAAGCGTGG
TGGGGCTTGGATGAATGTCGTCTTTTCTCGTAGTAGTGTGCTAGCTCGCCATGGGTGTTCTGTNNNNCTGCCTGTTGCCCATATGGTGTGTAATCAGNTG
CCACCAGTTGGCGATAAGCCCAGTCTTATGACCTTCCGTG
page-top