Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15603  (registered. 2012)
Contig Information
Length 488 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242073188|ref|XP_002446530.1|| hypothetical protein SORBIDRAFT_06g017640 [Sorghum bicolor]
Score 203
Evalue 5.00E-51
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15603
GAGCCCTTCTTTTGGCCTCCTTGAGAGTACAATTTTCACAGGATGGGTGCCTACTCTTCTTCGAGCTGGAAGAGGGATGACAATGTGGAGCAAAGCTGGC
ACGGTACCTGCAGAGAAGCTGGAACTCTTCTCATTTGAGAACAACACTTACGCAAGGATTGTCCGTGAGGCTCTGTGTGAATTGGAGCTCCCTTACGTTC
TCCAGAACGTGGGAGAGGGGTCGTCGAAGATGAGTTCGCTGCTAAGCATAGCAGGTTCTAAGCAGGTACCGTATCTGATGGATCCAAACACCGGGTTCCG
ATCGGGCGATCACAAGACGATACTGTCCTATTTGTTTCAGCAGTACTCTGTGGGAGGCTAGCTTCCCTCAAATCTCGGCAAATCTGTAGGCACCTCTCAG
ATAGGCTGTTTTGTCCCGGTAGAAAGAGAGCAAGCGTGTGTATTTGCCGCGATACGGAGCTTGGCTCTGAAATATCAGTGGGTTTTAG
page-top