Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15602  (registered. 2012)
Contig Information
Length 371 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222631569|gb|EEE63701.1|| hypothetical protein OsJ_18519 [Oryza sativa Japonica Group]
Score 202
Evalue 1.00E-50
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15602
GTGAAGTCAGATTTGGTCCGTCAACAATTTTTTCAACCCGAGAAGAGGCGGGTTATTGCCAATTCGGTTCCATCAGCTCCTTATGTGACATCATCTCCGG
TGCCTGTTGCAGTCCCACAAATTAAGGCAGAAACACGACATGTGGCAGCCGGCAATGAGATGAAAAGTGCAATGCATAACGGAAGCTTGCGAGACCCGGT
AGTTGTAATGCAGCGTCCTCAATCCGCAGCTGCCAAGCAAAGTCTACCATCCACAAGCCATAGTATGTTTGCATCAGAGCCACCTTCAAGGGAATGGTAC
ATGAATGGCGCATCNNNNGTGGATATGATGTTGAATGGTGGTTTAGGGCATGGACTACGTAATATGAGTTT
page-top