Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15601  (registered. 2012)
Contig Information
Length 771 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_VHS Shoot with heat shock treatment 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1915960|emb|CAA68913.1|| peptidylprolyl isomerase [Triticum aestivum]
Score 316
Evalue 2.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15601
CGCGACAATCTCTGCTCCGCCATATAAGACGCCACCGATCCGAGCCACGCCATGCTCCGGCTGCAAACAACATCCAGAACGCGCAGAGACGCAGATCGCG
AGCGAGCGCGCACCCGTTAATCGCTTCATCTTTCCATTCCACCTAGAGAGCCTTTCGCGTCCACGAACCGAACCAACAATGGCCGCCGTGGAGGATGAGG
CGCTGAGGGCGCTGGAAGAGGAGGACGACGCCATGATGAACGAGCCGGACGGCGAGCCCATGGACGGCCTCGACGTCGACGAGGAGGAGGAGGCCGACTC
CCCGGCGACGATGAAGGTCGGCGAGGAGAAGGAGATCGGGAAGCAGGGGCTGAAGAAGAAGCTCGTCAAGGAGGGCGAGGGCTGGGAACGGCCCGAGACC
GGCGACGAGGTCGAAGTGCACTACACGGGCACTCTCCTCGACGGGACCAAGTTCGATTCGAGCCGAGACCGCGGGACTCCCTTCAAGTTCAAGCTCGGGC
AGGGGCAGGTGATCAAGGGATGGGACCAGGGCATCAAGACCATGAAGAAGGGCGAGAACGCCGTCCTCACCATCCCGCCGGACCTCGCGTACGGCGAGGC
GGGCTCCCCGCCCACGATCCCGCCCAACGCCACGCTCCAGTTCGACGTCGAGCTCCTCTCGTGGGCCAGCGTCAAGGACATCTGCAAGGACGGCGGCATC
TTCAAGAAGGTCCTGGTCGAGGGTCAGAAATGGGAGAATCCCAAGGATCTCGACGAAGTTACTGTCAAGTA
page-top