Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15600  (registered. 2012)
Contig Information
Length 923 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_EM Dormant seed with water absorption 2
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115477601|ref|NP_001062396.1|| Os08g0542900 [Oryza sativa (japonica cultivar-group)]
Score 238
Evalue 8.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15600
TTTTTTTTTTCGAACAACTATAAAAATTTGCTCCTCCCACTGAAGACTTCTTTCTGTTGATTTGTCGACTCAAGTATGAATTTGTACTTTCAACTAGGAA
ATTCAGAGACCAAAAGACAGGTCCATGGACCAGCAGTAATGCAGTATACTGACGCATGTATCAGGGTATTACTATCCTTCCTCTTCATGGGATCACATCA
AAATGGGTCATCATATAAGCGCCGTTCTGCCAACCCCTCCCGAGAACAGGGCAACAGGGTACCACTAAGCATCAGACAGCACTGCCGGGCTGACCTGGGG
CTTCCCTCGCCCCATGGCAAATCCTTTTGTGCCGTCCGGCATACGCGGACCAGGAGGCGGCTTGGACACCACCGGATGCTCAGCACTGTGATTCGATGGA
GGAGTGCCGATTGGGTGCCCGCCGTCCCGGCTCTGGCCATGGTACTGGCCCCGGCCCCGGCCTCTTCCACCGCGTCCTCGGCCTCTCCCTTGCCTCATTC
CAGCTTTGTCATAGAAACCATCCTCACCCTGGGCAGCATCTTCTGCTTCATACTCTTCAGGATCATCTTCATCCGCAGCCTCCTCATCTCCACCTTTTCT
TCCTTGACCAATCCCATGTTTCAGGCAACCAAGCAGCGAACGAACTCTAGGCCCATCCCTCCAGTTTCTGCCGCCGCTAAACTCAGCAACCGCCTTTTCA
GCATCTTCAACAGTTCCATACTCCACAAAAGCATGCAGCTGCAAGCACAGCAAAATAGAAACGACATTGGAACAAACAGGTGTGAAAATATCTTACAACT
GATACATTGCTTCGGAAGAAGCTATGCTATGACTCACCAACGTTGAGNATTCATATAGAGGTAGATAGATCATACACATACCTTATTAGCAAAAAGCATC
TCAATCCTTGATGATTTGCCGGC
page-top