Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15597  (registered. 2012)
Contig Information
Length 486 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XB Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig15597
TTTTTTTTTTGATGGCAACAGCTAGCTGCTTGCAAAGACGATCTCTTACAGCACAAATATAGTTCTATCAAACCAATACTGTTCCTAACACGAAAGGCTT
TGTTTTCAGGGTCTCCTAACGCTCTGCATATAGAAACTAAAGAATACAACACAGCTTTAATCTGTAGCCGCTACACCAAACTACGGGCAGGCTCAGCAAC
AAAGATTACACTTGTCCCCGGTTACGACTTTAATTCAACAAAACCAAAAATGTTCTGATGCCTCTGATTAGGTAACTCAAGATGAATGCCCAACTTCTAG
GAGATCCCATGGAGATGAGTGCGCTTATTGCATCCTAGAAAAAACCACAGGGGTTTACACTCATTTCCCATAGGGATGGTACCTGCTAGAGCCCCGACCA
CCTGCACTCCCACCACCACCTGCAGCACCCCCCGCCCCTGCTCCTGCTCCTGCTCCCCCATAACTACCATATCCACCAGCACCGTA
page-top