Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15594  (registered. 2012)
Contig Information
Length 406 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|14275746|emb|CAC40029.1|| P-type ATPase [Hordeum vulgare]
Score 261
Evalue 3.00E-68
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15594
GCATACACTTGTAAAGCATTTGCGCACAACATTCAATGAAGTTGTTGCTGTTACTGGTGACGGCACAAATGATGCTCCTGCCCTGCATGAAGCAGATATT
GGACTTGCAATGGGCATTGCCGGGACTGAGGTGGCGAAAGAGAGTGCCGATGTCATCATTCTGGACGACAATTTCTCTACAATTGTAACTGTTGCCAGAT
GGGGGCGCTCTGTTTACGTCAACATTCAGAAATTTGTGCAGTTTCAGTTAACTGTTAATGTTGTTGCTTTACTAGTTAACTTCTCCTCAGCTTTTACAGG
AAATGCGCCACTGACAGCCGTTCAACTTCTTTGGGTCAACATGATTATGGACACACTTGGCGCGCTTGCATTAGCCACTGAACCACCCAATGATGACTTG
ATGAAG
page-top