Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1552  (registered. 2012)
Contig Information
Length 1488 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_KMP Shoot grown under continuous light 4
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 5
Wh_VWD Shoot grown with dessication 8
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115436320|ref|NP_001042918.1|| Os01g0328700 [Oryza sativa (japonica cultivar-group)]
Score 796
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1552
TGTAGTAGGGCCTAAGAAGGAAACATAAATTCAATGGCATGTACAATGAACCCATGGCACTGGCAACTGTTAATTCACAGTATCGCCGACAGGGCGAAAT
GACAATCGTATGCTTTTTGTTCCCATACATCCAAAATTATTACAAAATTTTGGAACTTCCTGAGACAAGTGATAACAGAAAAAGGAGAAATCATATGTGG
ATGGCCTTAGAATGGGTTTGCAAGCAAGCCTCCTTGAGGGCCTCACTCACAGTGGGATGTGCATGGCATATTCGGGCAACATCCTCGCTGGATGCTCCAT
ACTGCAGGGCAAGCACAGCTTCATGGATGATCTCTCCAGCATTCTGCGCCATTATGTGCACACCAAGAATCTTGTCAGTTTCCTTGTCAGCCACGACCTT
AACCATCCCCTCGGCATCATCAATAGCCTTCGCACGGCTGTTTGCCATGAGCGGGAATTTGCCGACTCGGTAGGCAATTCCTGAGGCCTTCACCTGCTCC
TCCGTCTTCCCGACAGATGCCACCTCCGGATGTGTGTAGACCACACCAGGCACCAAATCATAGTCAACGTGACCTTCCTTGCCAGCAAGGAACTCGACAC
ATGCCACACCATCCTCCTCAGCTTTGTGGGCAAGCATGGGCCCAGGGATGGCATCGCCGATCGCATACACTCCACTCACATTGGTCATGAACCGCTTATC
GACGAGGATCCTGCCAGCCTTGTCCATCTCAACCCCAATGGCATCCAGCCCGAGCCCGGCGGTATATGGGGTCCTTCCAGCAGAGACGAGAACGATGTCT
GCTTCAAGGATGCTCTGCTCACCTCCAGCTGCAGGCTCAAGTGTTAGCTTCACCCCGTCTCCAGAGGTATCAACTCCGACCACCTTTGTCTTGAGCATAA
ACTTCATTTTCTGCTTCTGCAACATGCGCTGGAACTGCTTCCTGATTTCACCATCCATTGATGGGACTATGTCTGGAGCAAATTCAACAACAGTGACCTC
TGTCCCAAGACGGTTCCAGACTGAACCCATTTCCAGGCCAATGTAACCAGCTCCAATGACAACCATTTTCTTTGGGATACCTGACAAGCACAGGGCGCCA
GTGGATGAGACAATCTTCTTCTCGTCAATTGTAATCCCAGGAAGTGATTTTACATCAGATCCAGTGGCAATGATTATGTTTTTTCCTTTGACAACAGTGT
TACCACCATCGACCAAATCAACCGAAACTTCTGAAGGGGAAGTAAGTTTCCCAAAGCCTTTGACATATGTCACTTTGTTCTTCTTAAAGAGGCCTTCGAT
TCCTTTTGTTAACCCGGCCACGGCCTTGTCTTTCTGCGCCATCATGGCTGGGAGATCCACTTCCAGATTAGAGATTTTCACTCCATGGTGTGCAAAAGAA
GTCTTTGCTTCATGGTACATATGAGAAGAGTGCAACAGAGCCTTGGAGGGGATGCATCCGACGTTGAGGCAGGTGCCGCCGAGGGTGC
page-top