Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15423  (registered. 2012)
Contig Information
Length 981 bp
Clones alternative view 36 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XV Leaves, plant was grown at constant 23 5
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|31415923|gb|AAP50944.1|| unknown protein [Oryza sativa Japonica Group]
Score 351
Evalue 6.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15423
CACACATACTTTTTTTTTTAGTAGTCAAGAACTCTATTCCCAAACATATATATACAGATATACATAGCAGATATCATACGAAAACGGCAAAAAGGGTGTT
ATCTGAATCTAAAGCGAAGAACTAAACACCACAAAAACATACGCACCATTACATAGTTCCATTTATCCACTCAGCAAAAACCAACTAAGCAGGCAACAGG
CAATCCAAGGTTCCATGCTCGATGCCAGGAGAACAGAGCTTCAGGCTGTACATCTGGAAGGCAAGGCTGGTTCATGGCGTGATTCAGTCGGTCTCATGGT
CTGGGCGAGGGGTATACCAGTCGGGAAACCTCCCCATCCTTCTGAGCAGCCTCGTGTAAGGAGACTCCGGCATGAGGGCCTCCTCATCCTCGTCGATCTC
TTCCTGCGTTTTCGGCAGCCCGTCGGGGACGGGGAAAGGCCTCGGCTTCGCTGTTTGCCCCGGGGAGTTTGATGGCGCCGAATTGTGAGCTTTCTCGGCC
ATCTTCTTCCGTAGGTCTGACCGGTGGTGGATGCTGCTTATAAGGTACCTCGGGTCTGACCGCGAGTCCTTCACCATCCTTGAAATTTCTTCTTGCGGTA
GCTCTTGCTCGAGTTTGTTGAGTTCAAAATAGGCATCCCAGCAGCTGCAGCAATCATCACCCTCAAGGGTCGTGCAATAATCTGTGATGTGGTCCTTGGT
GCGCTGGACGAGAGGCTTCTCCTGCTTGAAGAACTCGTCGAGGATGCTGCGGCTGGAGCTGAAGGGCTCCCGCTTCGGGATCGAGCCGTAGTCCCGCAGC
ACGCGCACCGCAACCGAGCGTCGCCCGGGCGTGGCCGAGGTGACGGTGGCGGTAGCAGTAGCAGTAGCGGTGGCTGGGTACGCGGGCGTCGTTGCCGTCG
CCGGCGACAGCGGCCGGAGAGCGGTGGATGAGAGCATTTTGGTGTTTGGTCCTTGTCTCGTCGGTTTTACTTCGGTGGGTT
page-top