Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15408  (registered. 2012)
Contig Information
Length 2499 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_SH - 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 5
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115474875|ref|NP_001061034.1|| Os08g0157900 [Oryza sativa (japonica cultivar-group)]
Score 783
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15408
GATCTACTCCCTCCATTCGGAATTACTTGTCACAAAAATGGATGTATCTACAATTAAAATACATCTAGATACATTCATTTCATGGACGAGTAATTCCGAA
CGGAGGGAGTAATTAGGTTCAGACCTTATATCATCACAACAACACGCATAATGGATGACTACAACATGGTTGCCAACATCTGCGGTGACAGGAGAACAAA
AACTAGCATGTACTAAGTCACAGGCATCTACAGCAACAGTTGCTCCTTGCTTCATCCCGCTTCTCATTTGTTACCTCACTTCTTCATTTCACAGTAACAA
ACACTTCGCTGTCTTACAACCGTCTTAAACGCAGGCAGCAAGACACGGTATGTACAATGCTCACAGCCGATGTGGAGAAAATGTGACACATTAAATCTGA
CCATAAGAGAGCTATTATGCCCATCCATAGATCCCAACGCTGACAAGGACGAGAAGAGCCACCGACAGAACTGGCAAGATCATGCGTGCTGCGAAGCCTC
CCCTCTTCCTTGGTGCTCTCACATGTGACTGGAGACCACACTCCTGCTTGCTCTCCTTGTCGCTTTTCTCTGCCGTCTTCCGCAGCCTCGTACCAGAATT
AGCTTCATGATCAGGCATGTACATTTGCTCATCAGCATGACTGTTGCCAGCGTCGTCAGGGAAGTCTGTGTCCACATGCTCTTCAATCTCAGCTTCCAGA
CCTTCGTTTTCACTTCCATGTTCTATAATGCAACTTGACGAACCATCAACACTGGAACATGATCCTGCATCGAGGTTCGATTGTAGCCGTAACCTTCGCA
CTGCAGTCCCTTGTTCGGTGGTAAATGAGCTATCTGTGCTTGAACTTGGAGCTGTGTGTCGGCTCATAATATTAATCCCTGTTGCCTCGGCATCAGCTTC
ATCAGAACGCATATTTGAACTTGGAGCAGGGCGCCGGGCCATAATAGTAATCCCCGTTGATTGAGCATCATCACAGTTGGAAGGCACACTTTTAGTTAGA
GCACGGCGCCGGGTCATAATAGTAACCCCGGTTGAGTCAGAATCATCTACATCTGCAGATGACTCAACAGATTCACTCATATACTTCGAAGTTACAATAT
CTGATTCTTCATCTTCATGTTCATCTCTGGTCATGCTCTCTCTACTCTCAACATTGACATCAGACAATGAATCCAGTAGCCGAAGCCTCCTGGGTGCAAT
GCCCTGTTGAGAAAATATATAGTTCGGATGCACAGTAGACTGTAACTGCTGATGCATGGGATTAAATCCAAATCCGTTGCTCCATACATCATTCTGCCCA
CTTGAATCGTCCATACTATTGAACAAATCTTGCAAGGACTCATCACCGGAGTCCATGGAAAGTACATCCGGATTAGTGCCATAAGGAAGCAATGCTGCAT
TCTCATATAATCCACTTTGTTGTGGATTTGTGTCATCTGACAGAAAATTACCGAACCAGTTTGGACCATCATATAGCAACTCACCCTGAGCCTGCATAAA
ACCAGTGTCTGCATCATACTGAACATTACATGCAGTTGATGAATGCTCATCCGGATCAGCAATTGTTTCATTCAAGAAATCTTCCACTGAATTATGAGGT
AACTGAAGTAGAAGCTTGTCCAAATCGTCATGCGATAACATGGGGGCAGAAACGGTTGCAAATTCATGAGATCCGAGATTTTTCGTCTGTGAATCAATTA
GGTGAGCCAAAGAGCCAACCGACATATCAGCCTTGGGACTTTCATCGACATTACCATGAGAAGGCATGCCTAAAACATTTGCTTCATCTATCCCCGAATT
GCCATTTCGGTCTGCAAGCCACCTTGTAACCGGTGTGCCCGGAGTATCAATTGTACCTGGCAACTCAATTGGACATCCATGCAGACCAGATTCAGGAGAT
TCCTTATTTATGAGTGTGATAGCTTCCTCGTTTGCTTCCATGTTGTCAGGAGTTGAACGAGATGGAGTGGGAGAGTAGCCACTTCTATCCATTTCCTCTA
GAATGAAGCGCTCAGTTTTCTCCAGTTGCTTTTGAAATAGGCGGTAGAGAACATAACCACCCTGCTCGCCAGACTCAAACTCTGGCTCGGTGGTGCGGTA
CTCGTGCATAATCCAACCAGTGCGCTCCCCTTTCGGAGCACGTCCTCGGTGGAAAACAAGGGTCTTCTTCATGCCAATCATATGCTGCTTCTTCTTCTCG
CCCTTGGACTTGATGACCCTGTCCTTCCCGGTCGCCTTCCAGTACCCAGCCTCCGTCGCCCTGTTTGACCTGCTTCCATTGGGGTACTTGCGGTCCTTGG
GTGCAAAGAAGAACCACTCCGGATCCTCCGAGCGGATCAAAGCTTTATCTGGGAGGTCCCACGGCTCGCACTTGCAGACGTCGATCTCCGGGATCACCTC
GACCTCGTTCTTGATCTGCCCCGTGATCTTCCCCTTGAGGTAGTGCCTGACGAGCTCCTCGTCGGTGGGGTGGAACCGGAAACCGAGCGGTAGCGCCTT
page-top