Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1537  (registered. 2012)
Contig Information
Length 566 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222631951|gb|EEE64083.1|| hypothetical protein OsJ_18914 [Oryza sativa Japonica Group]
Score 158
Evalue 3.00E-37
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1537
ACTAAATAGCACTAGGTCAGACAGTACATTACATGAATAAATAGTACCATCAATTTAAACCTCACTGATAAAAATCAAGATAGGAAGTACATCAACAGAC
AGCTCGGCCACACATGCAGAGTTTCAGCAAAGCCTCTCCAGGAATTCAGAGAAAGCGGAGAACAGATCAGGACAACGCATGCCACAATCAGCTTGTCCAA
CGCCAATCCATGTTGTGATTAGATGATGCGAACAACGCCATCCCTTATCATTATCCTGTTTGCATCTTGCATCCTCTCCAGGATGAACTCTACTTGGCCC
CTAGTGTAAGCAACAGCTGCATCTCTGTTGACTGTTTGCTCAACTTCATCAATGGACATTTGATCAACATGGTTTGCCAGCACATGCTGTCCAAGAATCG
CCTCAAATGCTTCCATTCTCTGTGAAGAAACATCCTGATCATTTGATGCATTGCCTGAGCCTCCATCCACATCCATTGGGTCGTCAGAGCTTNNATGCAC
GTCTGCATTGCCACCGCTTGCACCTNNGGGCCCATCTACATTATCACCACCTGCACCTGCATCTTG
page-top