Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15368  (registered. 2012)
Contig Information
Length 868 bp
Clones alternative view 30 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 3
Wh_KMP Shoot grown under continuous light 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115489760|ref|NP_001067367.1|| Os12g0636800 [Oryza sativa (japonica cultivar-group)]
Score 326
Evalue 2.00E-87
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15368
TGACGAGCTCCTCCACGCCGTCCCGCAAGGCGCTGAGCAAGATCGCCTGCAACCGGCTGCAGAAGGAGCTCGCCGAGTGGCAGGTCGGCCCGCCCGCCGG
CTTCAAGTACAAGGTCTCCGACAACCTCCAGAGATGGGTGATCGAGGTGGGCGGGGCGGAGGGCACGCTCTACGCCGGCGAGACGTACCAGCTGCAGGTC
GACTTCCCCGAGCATTACCCCATGGAGGCACCTCAGGTCATTTTCCTCAACCCGGCGCCGATGCACCCGCACATTTACAGCAACGGGCACATCTGCTTAG
ATATACTGTATGACTCGTGGTCGCCTGCGATGACTGTAAGTTCAGTCTGTATCAGCATCTTGTCGATGCTGTCTAGCTCGCCAGCAAAGCAACGCCCGGC
GGACAATGACCGCTACGTTAGGAACTGCCGCAACGGGAGGTCGCCGAAGGAGACCCGATGGTGGTTTCACGACGACAAAGTATGAGGGGGCATCGAATCG
ATTGGCTCTTCTGGCCACCCCATACTCGCCAGCCAGCCTTCCTTACTGTGAAAGAAATCTCTTCCAAGGGGAGATGAGATGAGATGATTTAGGCTTAAAA
ATTTAAGCTAAGCAACCCCTCTATCGTACTGCGGATCTTAACATGCTGTGGTGGTTTGTACATGAGCTCAACACATGTTGTCGAAACGTGAATACATCAT
CGCTACCGACGATGAGAGATATATAGAATAAGCAAGTGTAACCTGTCGATGCGCTGGTACAGGCACAAAAGGAATGCAGATTTATCTATGATTTGCTACA
TCGTTTCGTGCTATCTGTCCGCCTATAAACTTTGCTAGCCTGCTGACTGATGCCCTACTAGGTATATA
page-top