Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15236  (registered. 2012)
Contig Information
Length 793 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242093418|ref|XP_002437199.1|| hypothetical protein SORBIDRAFT_10g022750 [Sorghum bicolor]
Score 202
Evalue 4.00E-50
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15236
GTAGCAGCACCAGCACGGATCCGCGGCAGCACCAGCGATGGCAGAGTTCTCGTGGCTCACGGCGCTAGGGTTCGTCTTCCTGACCTTCAACTCCGGCATG
GCCGTCTACCGCTCCAACGGCGACGCGGGGTCCGTCATCTTCGTCGCCATCTCCTACCTCGACCTCGTGGCCCTCTTCGCCTGCCTGCGCCTCTACGAGC
GCCTCGACCGCCACTCCCCTCGCCGGGAGCGGATCAAGGCCGCCGTCTGGGCGCTCACCACGCTGCTCACCGTCATGTTCACCTACAAAGTCGCCGAGGT
CATGCCGCTCGCCGTCAAGCTCCTCGTCTGGGCGATGGCCGCCGCCACCACCTTCGGCGGCTTCTACGTCTTCTTCGTCCACGACGACAAGCAGTACCAG
CAGCTGCAGGACGCGTCGGCGGCCGCCGAGCGCGGGGACGTCGCCAACTAGTAGCTGTACTAGACGGCGGCGGGGCGCTTGCCGCCGCGAGGTACGTGCT
TCGGTGCTAACAGCGGCGTGGGGCGTTAGATCTGGGGGCAAACTACTAGGTCGTTCCTGTATCTTGGCTGTTCCTCTTCGCTTTTTTTGCCGGCTTGCTG
TCACATGCTCTGCTTTGGCTTGCCGGTGTGCTCGGATTAGCAGATCTGGAATTTGGCCACCGGCAGAGGAGATCTGTCCAGTTTGATTATATGCTTGTTG
ATCACATTGATAATTGTGTGCCCTGTTGAGAAGTGAGTTTGTGTTAATTATAGTTCCTGANNGGACCACCAAATTGGGCGTGTGTCCGCCACG
page-top