Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15222  (registered. 2012)
Contig Information
Length 1036 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_VABA Shoot with ABA treatment 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125606572|gb|EAZ45608.1|| hypothetical protein OsJ_30275 [Oryza sativa Japonica Group]
Score 210
Evalue 3.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15222
TCGTCTGCAAAGGATTCAGCCCACCGCCCGTTGGGAAGGGAGCTTNGAGGCGGCCGACCGCGGCACTTCGGCCGGACCGGCTTNNNCAATGGCACGGGCC
CTTGGGGGCGCAAGCGCCCCTAACGTGGGTCGGGGCGGGCGGCGGGCGCAGGCGTCGCATGCTAGCTTGGATTCTGACTTAGAGGCGTTCAGTCATAATC
CGGCACACGGTAGCTTCGCGCCACTGGCTTTTCAACCAAGCGCGATGACCAATTGTGTGAATCAACGGTTCCTCTCGTACTAGGTTGAATTACTATCGCG
ACACTGTCATCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAAACCCAGCTCACGTTCCCTATTGGTGGGATCCATCCAATCCAACCCGGCGCACG
CAGCGACGACTCGCCGGAGAAGATTCCCGTCGGGAAATCAATCCATCGGAGGAGCTCCACGATGGCGGGGGAGGGAAGGCCGGACGCGCAGCTCTTCCAG
CTCCTCACCGACCTTCTGCAGGAGGTGGAGTCAATGAGCAACCAGGAAGAGGTAGAATTGAGAGCAAAGATTGAAGCGCTGGGCCTAGAAGTCACTAAGG
TTCCAGAGAAGGCACCTAAGCAACTTGATGAGTTAGAAATAGCTGCAGAGCTGGACAGGCTGTCGGCAAGGCTCGATAATGTCGACAAGATGATATCATC
TGCCATGACATCTGACCCCGAGGTGAAATCGCTTCTGAGCAGCACCGCCGATGTCTGGATGCCCGTCATCACCGCGTCTGCTGATGAAAGGCGAGGGTTT
GCGGAAACAAGTGGCAACAAGGGAGAGCAAGAGAAATCTAAGTAAATAGCTTGGACTGAAGCCCTTGTAGTCCTTTGTGCCAGCCTTGTTCTACATGTTT
CTTACATGAGTATATGTCCATAGCTATGTATCAAATGTTCTTTTTTGGGGGCATAACAGAAAATAATCACACATGTTGTTCATGTACTATAATAACTAAT
TTGTCGGATGGTTTGAGGTAATAAAGTCTGCCAAGT
page-top