Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15138  (registered. 2012)
Contig Information
Length 856 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_PCDAM Anther at meiosis 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 3
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|255677563|dbj|BAF20955.2|| Os07g0180900 [Oryza sativa Japonica Group]
Score 335
Evalue 4.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15138
TTTTTTTTTTGGGAAAACAATATCAAACGGCATTACGACAGAGTATATATATATATGAAAAACGCAACTCAAAATCTGAACTAACGACTCGACGGTAAAG
CATGCCATAGAACATGTCTCGCAAAATGCGTCCACAGATAAAACACTCCAGATAAACAGCTAGCAAAACAGCATTCGATGTCTCAGACTCGGGATAATCG
ATTACATGACACGGTAATGACAAAATCATACTTTAGGGACGATAAACTGCTACTACAACGAGATGATCACTGGCTGACGCCAAGCCACTTGGAGAAGACG
TCGAACTCCGTGTAGTCGCTGTCAGAGATCATCGTCTGGTACCAGGCCTTCCCAGCAGCCTTGATCTTAGATGCCTCCTCCGCACTGAGCTTGGTCCTCT
TGGAGTTGATCTTCTCCTTCCTGGCCTTGACACGGGCTGCCTCAGCAAGAACTGCCATCCTGCGGGCAGTTCCGAAGTAGGGGTTGAGCTTAAGCACGGC
AGCAGCATTCTTCAGAGGGTTCTTCCTGGCCTCCCTGCGCTTCACCTCCTTGTTGATGGGCTTCACCACGGACTGGACCTCATCAGAGTTGATGAGGCGG
CCAAGGTCAGCATTGGTCATCTTAGGCCTTGGGAGCACGAAGCCCTTCTTCTTGGAGGAAGACGCCTCAAAGGAGCCGTACACCTCGTCCAGCTTCTTGA
AGGCAGACTCAGTCCAGATAACGAACCGGCCAAGGTGGCCACCAGGGGCANNNTCGAGCAGGTTGAGGCGCTCGACGTTGGCAACATCCACACCAGNNNN
NTTGCGGAAGGCCTTGACGATCTTGGAGCCCTCGGTGCCGTAGACGATCCTCGTGC
page-top