Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15136  (registered. 2012)
Contig Information
Length 1096 bp
Clones alternative view 67 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_CSEC Callus 3
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 31
Wh_SHC Shoot grown with cold treatment 3
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XA Root 2
WH_XB Root 5
WH_XD Root, treated at 50 microM Al for 6h 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|4741848|gb|AAD28733.1|AF112966_1|AF112966_1 chitinase IV precursor [Triticum aestivum]
Score 407
Evalue 1.00E-111
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15136
GTACCTAGACATGAGTAATAAACAAGAACATAACACTTTTTGCTTGTTGATGAGGAAAAAGAGTATAGCTCGTGAACAGTACTACTGCAAGGATCTTGGT
ATGTAGTAGTAGTACACCACATCCTCGCCCTTTATTTCTTGTTTGGACGGCTTTAGACGCGTACGCGCACGCCGGACGTTTATTCTACATAAGCCATGCG
TGTTCTCTGTTCTATGCATGGTCGATCTCGATCAGGCCCGCCCGAAGCACCTAGCAAGTGAGGCTGTTCCCCGGGTCGACGCCGAACTGCCTGCAGTAGG
CCCTGTAGTAGCCCGCCCGGGCGTTCATGGCGGCCGCGTTCCCGCCGTTGCACTCGCCGCTGTTGATGGCCCTGGTCGTGGCGCCGAACCCCCGCGGCAG
GACCTGCTTCACGTTGTTCATCCAGAACCAGAGCGCCGCCTTGAACGCCACCTCCGGGTCCTGCGCCACCTTCTCCGGGTTGTTCAGCCCGTCGAATCCC
ACGCTCTTCCCCGCCGCCCCGTAGTTGTAGTTCCACGTCAGCTGCAGCGGCCCGCGCCCGTAGTACCCCTTCCCCGAGGCGCACGGCCACTGCGTGTACT
TCCTGTCGCAGTAGTTCTGCCTCGCCCCGCCGATCTCCTCGATGTAGCACATGTGTCCGGTCTCGTGCGTGACGTGGGCGAAGAAGGCGGCTATCTCCCT
CTTGCCGTCGTCGGTCGTGCGGCCTTTCCCGAAGTTGGGGTTGGCCCGGGCGGCGCTCAGGAACGACGGGCGCGTGTAAAAGCTCTTGCCGGCGCACCCG
TTGCCGGCCCGGGACTTGATCCCGTTGAAGAACGCCTCGGTGACGACGCTCTCCACGGAGACGCCGCTCCCGCCGCCGCCGCCGCTCCCCGAGCACGGGC
CAGACTGACACCCTTGTCCGCAGTAGGCGTCGGTAGTGCCGCAATACCCGTACTGGCTGCAGCACTCGTTCGCCCGGCAGCCGCACTTCTGCGCGGCCAC
CATTCCCGCGGCAGATAGGACTAGTGCTGCCACCCCGAGCGCCAAGAACGGGAGCATCGCCATGGGCGACCTCGCCATTTCGAAATAAGGTTAACG
page-top