Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15111  (registered. 2012)
Contig Information
Length 865 bp
Clones alternative view 49 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 14
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 14
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|21730248|pdb|1GWC|A|A Chain A, The Structure Of A Tau Class Glutathione S-Transferase"
Score 437
Evalue 9.00E-121
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15111
TCTTCAAACACACACACACACACACAAAAAACATCGATCGAGGTAGTTAGAGATGGCCGGACGAGATGACCTGAAGCTGCTCGGCACATGGCCAAGCCCG
TTTGTTACCAGGGTGAAGCTGGCACTCGCCCTGAAGGGCCTGAGCTACGAGGACGTGGAGGAGGACCTGTACAAGAAGAGCGAGCTTCTCCTCAAGTCCA
ACCCGGTGCACAAGAAGATACCAGTGCTCATCCACAACGGCGCCCCGGTCTGCGAGTCCATGATCATTCTGCAGTACATCGACGAAGTGTTCGCCGACAC
CGGCCCGTCCCTTCTCCCAGCGGACCCCTACGAGCGCGCCATTGCTCGCTTCTGGATGGCCTACGTTGACGACAAGCTGGTAGCCCCATGGAGGCAGTGG
TTGAGGGGCAAGACAGAGGAGGAGAAATCCGAGGGAAAGAAGCAGGCGTTCGCGGCGGTGGAGATTCTTGAAGGGGCCCTGAGGGAATGCTCCAAGGGAG
GGGGCTTCTTCGGCGGCGACGGCCTCGGGCTCGTCGACGTTGCGCTGGGAGGCGTTCTGTCGTGGATGAAGGTGACCGAGGTGTTGTCCGGTGACAAGAT
CTTCGATGCCGCCAAGACCCCGCTCCTGGCCGCATGGGTGGAGCGCTTCAGCGAGCTCGACGCGGCCAAGGTGGCCCTGCCAGACGTGGGCAGGCTGCTT
GAGTTCGCCAAGGCACGAGAGGCTGCCGCTGCACCGTCTAACTGAGCCAGCACACATCCAGAATAACTAAAATTTGCTATTTTTAAATGTTGTTTGTTTG
GCTGCTTGATGTAATAATGTAGCAGTAACTCATGTCATCCATTTATTCAGTATTGATTATGTCCT
page-top