Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15107  (registered. 2012)
Contig Information
Length 1231 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_SP 2
WH_XE Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125527438|gb|EAY75552.1|| hypothetical protein OsI_03457 [Oryza sativa Indica Group]
Score 443
Evalue 2.00E-122
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15107
TATTTCTAAAAGGCCACACGACATTTGTTCCTTGAAGGCACATTAATAGTCAGGAAACGTTACCAGCCAAATTTGTTCGAAAAAATTCTACATGGTCAAG
TTCCAGTTTCCAAAGACAAAGTCCTACAAGCTGCACTTGGCTGTGCCAAGACAATGGCAACTGGACAAGGTGCACCGGAAGGAATAGAAATAATACAACA
GACTCACAAGCGCCACATAAAAAACTATAAAGATTAAAGACATTTACAGAACCACCCCAATCACATTAAATTATGAGAGCTACATTCCTTGTGCCTCGGG
CTGACCACTTATTTACCGTGTCCAGAAGACCACCACCATCATCTGGCAATAGCACTTCACATCCTCCTCGTAACATCTCCTGTGATCCAAAACTCAACAG
GAAATGCTGTGCTTATCTTCAGATTATAATTTATACACAGCACACGTAGAAGAGGAATCGTTTTCTCAGTGCTACTAGTACTGAGCCCTCTCATCGCCAT
CGAAATTAAGACCTTCAATACCTTTGAGGGCAGACTCGTAGTTCTTCGGGTTAGATGAATGCCGAGCCGAAGAGGAACGCTGTGGTTCTGCAGAATCAAC
CGGTGGGCTTCTCTGAGCACCTGAGGTTCTACGGAATGCACCAGGGCTTGCATCAGTCGTGCGTGATCGTGAAGGCTCAAAAGTGTCACTTGCCACAGCA
TCCCGGCTACTTGAAACAGCAGCTCTCCTTGACGATCCACTTGACCGCCCCAAAAAATTCGAGCCGGATATCGCAGGGTCTTTAGAAATAGGAGCATCAT
TTCCTACAGGGGCTTTCTGCTTATTTGAAGTCCCCACGCTTGCAATGGGGGGTGGGGCACGACGTCGGTCCATTGCTGACCAACCACTAATCCTCCCTTC
AACAGCACCAGATTGACTATCATTCTGCAATACAGGTGGTGTCAACCCAGAAGGTCCTGCACCATGGCCTGCAACACGAGGCGGGGCACTAGCAATTTGA
GATTGCTGGTACTTCAGTATTGTCCAGTCAAATACATAGTCAAACTGAAAACCTTCGCGGATAAAGAGGTCACGGAACAGTCGCTTAAGGTAGGAATAAT
CAGGCTTGTCATCAAACCGAAGCGAGCGGCAATAATGGAAATATGATGTGAACTCAGTAGGATACCCACGACACAGAGCCTCAATTGATGTTGCAACTTT
TTTCTCACTGATCTTCTCATACTTTTGCTTC
page-top