Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15076  (registered. 2012)
Contig Information
Length 1720 bp
Clones alternative view 61 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_RDr Root of dessiccated seed 7
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 17
WH_XF Seedling, infected with leaf rust 7
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115474609|ref|NP_001060901.1|| Os08g0127100 [Oryza sativa (japonica cultivar-group)]
Score 839
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15076
TCTCTGCACATCCTCCTCTCACACATCCCCCTCTGTTCTGTTTACTCTCCATTGCTCAAGACAAGGCCCGGCCGGCAGAACATGGGGACGCAGGCAGCGG
AGAACTTCGAACCGCCGGCCAAGGATGTCAGGACGGATGAGCAGAAGAAGATTGACGACTGGCTCCCGATCACGTCGTCGAGGAACGCCAAGTGGTGGTA
CTCGGCCTTCCACAATGTCACCGCCATGGTCGGCGCGGGGGTGCTCAGCCTCCCCTACGCCATGTCCGAGCTCGGCTGGGGCCCTGGCATCGCGGTGCTG
GTCATCTCGTGGGTGATCACGCTCTACACGCTGTGGCAGATGGTGGAGATGCACGAGATGGTGCCCGGGAAGCGGTTCGACAGGTACCACGAGCTCGGGC
AGCACGCCTTCGGCGACAAGCTGGGGCTGTGGATCGTGGTGCCGCAGCAGCTGATCGTGGAGGTTGGCGTGAACATCGTGTACATGGTGACCGGCGGGAG
GTCGCTCAAGAAGTTCCACGACGTGATCTGCGACGGCAAGTGCAAGGACATCAAGCTCACCTTCTTCATCATGATCTTCGCGTCCGTGCACTTCGTGCTC
TCGCAGCTCCCAAACTTGAACTCCATCTCCGGCGTGTCCCTGGCCGCCGCCGTCATGTCGCTGTCCTACTCGACCATCGCGTGGGGCGCGTCGGTGGACA
AGGGGAAGATGGTGGACGTGGACTACAACCTCCGCGCCACCACGACGCCGGGGAAGGTGTTCGGCTTCTTCGGGGCGCTGGGCGAGGTGGCGTTCGCGTA
CGCCGGCCACAACGTGGTGCTGGAGATCCAGGCCACCATCCCGTCCACGCCGGAGAAGCCGTCCAAGAAGCCCATGTGGAAGGGCGTGGTGGTGGCCTAC
ATCGTCGTCGCGCTCTGCTACTTCCCCGTCGCCCTCATCGGCTACTGGGCCTTCGGCAACAGCGTCGACGACAACATCCTCATCACCCTCAACAAGCCCA
CCTGGCTCATCTCCACCGCCAACATGATGGTTGTCATCCATGTCATCGGAAGCTACCAGATTTACGCGATGCCGGTGTTCGACATGATCGAGACGGTGCT
AGTGAAGAAGCTCAAGTTCCCTCCCGGCCTCACGCTCCGCTTGATTGCCCGGACCCTCTATGTTGCGTTCACCATGTTCGTCGCCATCACCTTCCCTTTC
TTCGGTGGCCTGCTCGGATTCTTCGGCGGGTTCGCCTTTGCGCCCACGACATACTTCCTGCCCTGCATCATGTGGCTCGCCATCTACAAGCCCAAAAGAT
TCAGCCTCTCATGGTTCACCAACTGGGTCTGCATCGTCCTTGGAGTGTGCCTCATGATCCTGTCGCCAATCGGAGGGCTCAGACAGATCATCTTGGATTC
CAAGACATACAAATTCTACTCATAGACCACTTCTACGACGCATTGTGTCCTGTGAAAACTGCAAGAGATCATTTACGATGCCTACCACGAACTCTCTTGC
TTGCAAAGGAAAAAGAAAGGAACATCATAGTACCACGAACTGTTACAGATGGGACGTTAGATGCATATGGTCAGAGAAAATTTGGTTTAGTCAAAGCAAA
TGGGATGTGTTTGTGGTTAATCATGTGTACGTAATATATATGGTGTGTGGATTTGACTCTGGGTACTGTAGAATCGACAATCTCTTTTTCTGCTCAAACT
TGCATGGATGAAAAAAAAAA
page-top