Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15074  (registered. 2012)
Contig Information
Length 712 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XF Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig15074
GGAGATAACAGTTGCCAAGTTCAACAGATAAACAGTTACTTATGTTCAGAGTCGACAGGGTGACTGGTATGTATCCCTACAGATAAACCCAAACTAACAG
CACATCCCACTGGTTTGTTTACACCTGAGCTAACAGCACAAGTTCCCCCCGCCTGTACAACGGCAAGCCAAGCCACCATCCAGCACATGAAACGGGTAAA
CATTTACATGTACAGCAACAGAGATCCCAAACGGGGACCAAAGGGGTCATCCGCGGTGCAATCTCGGCTGGCTGTCCCCTCTGCTACTACTTGCCCTTCT
CTCGCGGAGTTGACAGGGCGACGAGGATGTCAGCCGCCTGAGCGACGTTGCTGCCGGGCTCAGGGACGGGCGCTGATGGCTTATTGCAGGATCCAAATTG
TACTGCCTCCCCGGTTGTCGGTGCAGGAGCAGTATAACCCATGGTGGCTGCACTCGGCGCCTGAGAGTGCTCGCCTTCAGATGCTGTATGTGTTGTTGGA
GCCCCATGGAGCGCTGGCTCGTTGTTGCTTGATGCTGGAGGATCATGGCAGTTTGGCGCGATACTCAGTGCTAGAGAATCGCAGCCTTCAGCGCTCAAAG
CTGAAGAGTTCACATGTCCTGGCACATGAGCTGGAGCTGCGACAGAAGNNNTTGAATCACCACCATGGCACTTAGTTGGATAAATTGCTTGGCTTTGTGG
CGCAATACTCAG
page-top