Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15073  (registered. 2012)
Contig Information
Length 764 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125544159|gb|EAY90298.1|| hypothetical protein OsI_11873 [Oryza sativa Indica Group]
Score 261
Evalue 4.00E-68
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15073
CTATCTTGAATCTTACATGATTAAAAAGGAGTTAAATGCAAGTGAGGTCCTAATTCTTTTGCCGAAATGTTGAGTGAGTTTCATACTATGAAAGTGCACA
TTCCAATCTAAAAGTACTCTCTCCGTCCCAGAGTAAACAAAATGTTTTGCCCCTTATTACTTTTTATTTTTTTGCTCTTATGAAGCTGGGCAATATGCCA
AAGGGACCATTTCTTTTGAGCGTATGTATTGGTAGTCGTGACAAGTAGCTAGCTAGAGAGTGTAGGCGACGATTGCTGGTATCGGTTCAGGTCATCCCAG
ACCAAGTGCTCGACATCCTCCCACGACGTTGCATCCCTCAGCTCCTTCCACAGGCCAAATATAGCCGCCAAGACGTTGTCGTCGTGCAGTATGCAGTAGC
ACATCGCGCGATATGATGCGGTGCTGAACTTCGAATTTTGCACCGACTTGTAGATGTCGTTGTTTGATTTCCCTCTGAGGAAAGGAAGCTGATAGCTTCT
AAGGTACTCCCTCAGAAGATCAATATCACCACGGAAAACATCCAAGTGCAGCGGAATTAAGTCGCATAGAGGATCCCCAATGTACAGATCACTGAAGTCA
ATGATATGGATTTCATTCAGTTTCTCCAGATCTCCGTCACCAGTGCTTTTGGTATCAGTGAGGGAACCCATTTCGGGAGCCCTCTGAGNAAGAATGTTAT
CGTCCATAATATCTGAATGTATCCAAGAAGGGAATGTGTACACCGAGTCACCGTCGCCATCCTT
page-top