Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15072  (registered. 2012)
Contig Information
Length 816 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115434780|ref|NP_001042148.1|| Os01g0171800 [Oryza sativa (japonica cultivar-group)]
Score 221
Evalue 1.00E-55
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15072
CACGAGGAGCGAGTGAGACTGGTAGACGGGACACCAGTCCACGACTCCCGGGCCCCGACGCTTCCGGAGATCCCTCCGTCCCTGGCGCCGGCGACCTCAG
AGGAAGACCGGAAAACTGACAGTGCCGTGGCGGCAATCGGGCAGAGCTGGAGAGATAGGGAGGCGGGAGCTTGGAGAAGGCCGCTTCTTTCCTTCTTCCC
CCACGCTCGTCAGGGAGTCCAGCGTTCGGGTCTACTGACGGATCACCGCATTGCAATCAGCCATGGTCATGGACACCACTGACCCGGGCTACTGGCTCAA
CTGGAGGTTCATGCTCTGCGCGACCTGGGTCTACTCCTGTATGGCCCTGGCGTTCTACTTGATCTGGAAGTACGAGGGGCCAAGTTCGCCGGCCGGCAAC
GACGAGGGGGGCGACAGAGAGGAGGCTCGGCCCAGGATCGGACCCGGAGTTGTGTATCTTGAGGACTGCTGGAAGCCGTGCCTTGAGGAGATCCATCCCG
CTTGGCTGCTGGCTTTTCGCCTTGTGTCGTTCTTGTTCATGGCTTCGGTGCTTGTCTCTGATGTTATTGTCGATGGATGGACCGTCTTCCTTTACTACAC
TCAGTGGACCTTCTTGCTTGTCACCTTGTACTTTGGGGTATGTTGTTTGCTACAGTAAACTTGTTGTGACCACTTATTCTTGCCTACACATGAGAATGAC
AACAACATGTTCTGCCANNNNNNGAACAAATGGCCAATATAAAATATTTTTTGATTGTATAGCACGCAATTTGTTGTATCCGCATGCTTCCTCATTGCCT
ATTTTGCTGTCACTTA
page-top