Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15071  (registered. 2012)
Contig Information
Length 430 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218194089|gb|EEC76516.1|| hypothetical protein OsI_14296 [Oryza sativa Indica Group]
Score 136
Evalue 9.00E-31
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15071
CTCCTCATTACACACATTTATTGTATCAGATTCTTTCCTATAAACAAGTAAAGAAAAGAATCAAAGAAAAACAAGACTGCTACTGCATTCTACACAAAGG
CATCAATATAATGGTACAATGCAATTTCCCTTTCCTTCCCAATGTTTTGCACGACAATGCGCCGTGATGTTGATCATCATCACGGCAAGACACCGATGAA
AATCAGGCCGAGCTCCACTGGCTGGCCTTCTCGAAGCCGTTGCGGCCGTAGTAATAGTCCTCCATGGCCTGCTGGATCTGGGCACGCGAGTTCATGACGA
ATGGACCCTGCTGCACCACTGGCTCGTTCAGCGGCTGCCCCGCCGCCAGCGCGAACCGCAGCGGTGCGCCAGNNNGATTCCACACGCTGAGCCCGTCCCC
CGCGCCAAGCACGAGGCAGTGGTGCGCGCT
page-top