Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15066  (registered. 2012)
Contig Information
Length 942 bp
Clones alternative view 56 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_SP 1
WH_XA Root 3
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|20067417|emb|CAC94002.1|| glutathione transferase [Triticum aestivum]
Score 454
Evalue 9.00E-126
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15066
TACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTCCCAACACAGC
ACAAACACAAACCAATCGAGATCCAAAGCAACCAAGAGCAATGGCGGGCGAGAAGGGGCTGGTGCTGCTGGACTTCTGGGTGAGCCCGTTCGGGCAGCGC
GTCCGCATCGCGCTGGCCGAGAAGGGCCTGCCCTACGAGTACGTGGAGGAGGACCTGATGGCCGGCAAGAGCGACCGCCTCCTCCGCTCCAACCCGGTGC
ACAAGAAGATCCCGGTGCTCCTCCACGACGGCCGCCCCGTCAACGAGTCCCTCATCATCCTCCAGTACCTCGAGGACGCCTTCCCGGACGCCCCGGCCCT
CCTCCCCTCCGACCCCTACGCGCGCGCGCAGGCCCGCTTCTGGGCCGACTACGTCGACAAGAAGGTCTACGACTGCGGCTCCCGGCTCTGGAAGCTCAAG
GGCGAGCCGCAGGCGCAGGCGCGCGCCGAGATGCTGGAGATCCTCAAGACCCTCGACGGCGCGCTCGGGGACAAGCCCTTCTTCGGCGGCGACAAGTTCG
GGTTCGTGGACGCCGCCTTCGCGCCCTTCACCGCGTGGTTCCACAGCTACGAGAGGTACGGCGAGTTCAGCCTGGCGGAGGTGGCGCCCAAGATCGCCGC
GTGGGCCAAGCGCTGCGGCGAGCGGGAGAGCGTCGCCAAGAGCCTCTACTCGCCGGACAAGGTGTACGACTTCATCGGCCTGCTCAAGAAGAAGTACGGC
ATCGAGTAGGGCGCGCGGGCGGGCGGGCGGCCATGCAGGCGACAGCCGGCCGGCCGTCCGGAGGAAAGGAACAAATAAATCATGGAGCGATTTGGGTGGC
CTACAATGCGTACGTCTGGATATTTGTTTCTTTCTTCGTGGA
page-top