Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15065  (registered. 2012)
Contig Information
Length 1511 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125524620|gb|EAY72734.1|| hypothetical protein OsI_00599 [Oryza sativa Indica Group]
Score 870
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15065
CAGCATTGGACGTGATTGATGTTGCTAATGGAGGCAGTGAAACGATCTCTTTAAGCCTATCCAGGTCATTGTCATCATCTGAAGAGAAAGATAAACAAAA
TGGCAAAGACGACGGTGACAAGGTTCAGAGTGGGCAGCTGGTGCAGGAAGAAGAAAGGGAAAAGGGCAGGGTGGGGTTCTGGGTCTACTGGAAGTACCTC
ACATTGGCTTACGGCGGAGCTCTCGTACCATTCGTGTTGATAGCACAGCTACTTTTCCAAGTACTTCAGATTGCTAGCAATTACTGGATGGCTTGGGCTT
CTCCTGTGTCGAAAGACGCCAAGCCTCCAGTGAGCACGTCGACACTGATCTATGTCTTTGTGGCATTGGCTGTTGCAAGTTCGCTGTGCATCCTCATAAG
GGCACTGTTTCTTGTGACAGCTGCATACAAAACAGCAACTCTGTTGTTCAACAAGATGCATATGGCCATATTCAGAGCTCCTATGTCTTTCTTCGATTCC
ACTCCAAGTGGGCGCATCTTGAATAGAGCTTCAACTGATCAAAGCGAAGTGGATACAAACATCGCTTACCAGATGGGTTCTGTTGCGTTTTCCATCATAC
AACTAGTTGGAATTATTGCGGTGATGTCTCAGGTAGCATGGCAGGTGTTTCTTGTGTTCGTTCCTGTGATCATTATCTGCTTCTACTACCAGCGCTACTA
CATTGAGACGGCCAGAGAGCTGCAAAGGCTGGTAGGGGTTTGCAAAGCTCCTATCATACAACATTTTGCTGAATCAATTACTGGATCAACCACCATCAGA
AGTTTTGGCAAAGAAAATCAGTTTGTATCAACTAATAGCCATCTAATGGATGCCTACTCTCGACCGAAATTCTACAATGCTGCAGCAATGGAGTGGCTTT
GTTTCCGCTTGGATACACTGTCGTCCTTTACATTTGCATTCGCTTTGGTATTTCTTATCAGTCTACCAACTGGTATCATCGATCCAGGTATTGCTGGTCT
CGCGGTCACATATGGGCTTAACTTGAACATGCTGCAAGCATGGGTTGTGTGGAGCATGTGCAATTTGGAGAACAAGATCATATCAGTAGAAAGAATTCTG
CAATACATAAGCATTCCTGAAGAACCCCCACTTACAATGTCAGAAGATAAGTTGCCCCACAACTGGCCGTCAGNNNGAGAAATTCAGCTTTGTGACGTCC
ATGTGAGATATGCTCCACAACTACCATTTGTTCTGAAGGGCCTTAACGTCACTTTTCCTGGAGGCATGAAGACCGGTATTGTTGGAAGAACAGGCAGTGG
TAAATCAACACTCATACAGGCCCTTTTCCGAATTGTCGAGCCTACTGTCGGTCAGATACTGGTAGATGGTGTTGACATCTGCACCATCGGGCTGCACGAT
CTGAGATCTAGACTTAGCATCATTCCACAAGATCCAACGATGTTTGAGGGAACTGTGAGGAGCAACCTTGACCCTCTTAACGAGTACAATGACGATCAAA
TCTGGGAGGCC
page-top