Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15063  (registered. 2012)
Contig Information
Length 913 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125588289|gb|EAZ28953.1|| hypothetical protein OsJ_12999 [Oryza sativa Japonica Group]
Score 306
Evalue 3.00E-81
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig15063
ATTCTTGGCTGGATGGTGGCCGGAGCTCGCGGAGGACTCGAGACTGATGCAGAAGCAAAGCGTTTCAAGGCAAATAAATCCAGTGATGATAATGGTAGTG
TCAGAAAAGATGCTGAAGCTGATTCAAGAAATGCTAGTAAGGCTGTTGACCAAAATCCCCCGCCACCAAAGCAAGATTTCATCCATGTGAGGGCAAGAAG
GGGTCAAGCAACTGACAGCCATAGCCTTGCAGAAAGGGCACGGCGTGAGAAAATAACCGAGCGGATGAAAATTCTCCAAGATCTTGTCCCTGGATGTAAT
AAGGTTATTGGGAAAGCATCAGTCCTTGATGAGATAATCAATTATGTCCAAGCTTTGGAACGCCAAATTGAGTTCCTGTCCATGAAGCTCGAGGCGGTTA
ACGCCCATGCCCATGCTCACAACGGAGTTGAAACATTTCCAACTAAAGACTTCGCTGCGCCGGCATACAACACAGCTCCAGGGTTAACATTTGACCCGCA
AACACCAAGGGAGTACGCCCAGGGCTCGCCGGCTGCAGAATGGCTTCACATGCAGATTGGTGGCACCTACGAAAGAGTGACGTGAGCAGAACAAAAGTCC
AGGGTGGCGCCCAACAAAGCGTGCCATGAATCCTCGGCCAAGCAACCCCCACTTTCATACCGTAGATCATTTTTTTTTGCGCCACCATCTCGTTCCAAAT
GCGGTTTTATTCATAGTTTTTGGAGCTGTAATTGCCGGTAGAGACGTCAGACATGTATTTAGAGAGAACCGCCGAGCACGGTGCCTTTTTGTTTTGACCT
TCGGATTCAGGACTGTTCCTCATGTATTCGCAACCTTCATGTATTCCATGGATTTCTGTAGCTGGTAATCATTCTTAAGATGAAAGGAAGCGACTTTTTT
TTTAAAAAAAAAA
page-top